Saturday, January 2, 2021

Molecular Basis of Inheritance | Class 12 | Previous Years Questions and Answers (2018 to 2020)

 4. MOLECULAR BASIS OF INHERITANCE


2020 SAY

1.   Find out the initiator codon among the following: (1)

(a)    ACG                                 (b)  AUC

(c)    AUG                                (d)  AAG

ü Answer:

(c) AUG

2.   (a) Complete the flow chart given below showing DNA finger-printing technique.

(b) Who developed the DNA finger-printing technique?

(c) Write the full form of VNTR. (2)


ü Answer:

(a) (i)  Digestion of DNA by restriction endonuclease.

(ii) Hybridisation using labelled VNTR probe.

(b) Alec Jeffreys

(c) Variable Number of Tandem Repeats.

3.   Schematic structure of a transcription unit is given below: (2)

(a)    Identify a, b and c.

(b)   The coding sequences/expressed sequences in eukaryotes are known as ...................

ü Answer:

(a) a. Promoter. b. Structural genes. c. Terminator.

(b) Exons

4.   Lactose catabolism in the absence of inducer in E. Coli is given below: (3)

(a)    Identify ‘P’.

(b)   Draw the diagram in the presence of inducer.

(c)    Write the enzymes produced by the structural genes ‘z’, ‘y’ and ‘a’.

ü Answer:

(a) Promoter.

(b)


(c) z: b-galactosidase, y: Permease, a: Transacetylase.

2020 MARCH

1.   One of the salient features of genetic code is "Universal". (2)

a.  Write any other two salient features of genetic code.

b.  Which is the initiator codon? And name the amino acid it codes.

ü Answer:

(a) Genetic code is degenerate.

Genetic code is unambiguous.

(b) Initiator codon: AUG

Name of amino acid it codes: Methionine.

2.   Observe the figure given below: (3)



a.  Identify the process in the picture.

b.  Name any two enzymes needed for this process.

c.  Write the peculiarities of the newly synthesized daughter strands.

ü Answer:

(a) DNA replication.

(b) DNA polymerase, DNA ligase, Helicase etc.

(c) One strand is formed as continuous strand (leading strand). Other strand is formed as small stretches (Okazaki fragments).

3.   A DNA sequence is provided below. (3)

5' - ATGCATGCATGCATGCATGCATGCAT - 3'

a.   Write down the sequence of its complementary strand.

b.   Name the enzyme involved in transcription of DNA.

c.   What would happen if both the strands of the DNA act as templates for transcription?

ü Answer:

(a) 3' – TACGTACGTACGTACGTACGTACGTA – 5’

(b) DNA dependent RNA polymerase.

(c) It results in the production of 2 RNA molecules simultaneously. This would be complimentary to each other. It forms a double stranded RNA and prevents translation.

2019 SAY June

1.   In a double stranded DNA, the ratios between Adenine and Thymine, Guanine and Cytosine are constant and equal one. Who observed this fact? (1)

ü Answer:

Erwin Chargaff

2.  Observe the diagram of a double stranded DNA strand: (2)

Identify the bonds A, B, C & D.

ü Answer:

A= Hydrogen bond

B= Ester bond

C= Phosphodiester bond

D= N-glycosidic bond

3.  The following diagram shows a process in the Ribosome: (2)


Identify the process and explain.

ü Answer:

The process is Translation (Protein synthesis).

It includes 4 steps:

a.   Charging (aminoacylation) of tRNA.

b.   Initiation.

c.    Elongation.

d.   Termination.

4.   Transcription of eukaryotes are more complicated than that of prokaryotes. Explain any two additional complexities found in the transcription of eukaryotes. (3)

ü Answer:

·    There are 3 RNA polymerases: RNA polymerase I, II & III.

·    Primary transcripts (hnRNA) contain exons & introns. To remove intro ns, it undergoes processing (splicing, capping & tailing) and becomes mRNA.

2019 MARCH

1.   Diagrammatic representation of the central dogma given below is not correct. Make necessary corrections and redraw it. (1)


ü Answer:

2.   Observe the figure given below: (2)

 


a.   Identify the figure.

b.   How many histone molecules are present in the Histone core.

c.   Distinguish Euchromatin and Heterochromatin.


ü Answer:


(a) Nucleosome.

(b) 8

(c) Euchromatin: Loosely packed, light stained and transcriptionally active region of chromatin.

Heterochromatin: Densely packed, dark stained and inactive region of chromatin.


3.   Diagrammatic representation of the DNA fingerprint from a crime scene and that of a suspected person are given below: (3)


a.  What is your conclusion about the suspects based on DNA Fingerprint given?

b.  What is VNTR?

c.  Who developed this technique first?

ü Answer:

a.     Suspect II may be responsible for the crime. Because DNA from crime scene matches with DNA of suspect II.

b.     A DNA sequence which is tandemly repeated in many copy numbers is called variable number tandem repeats (VNTR).

c.      Alec Jeffreys.

4.  The diagrammatic representation of a process in bacteria is given below: (3)



a.    Identify the process.

b.    Name the enzyme involved in this process.

c.    Explain the three major steps in this process.


ü Answer:

a.  Transcription (RNA synthesis)

b.  RNA polymerase.

c.  Initiation: RNA polymerase binds at the promoter site of DNA.

Elongation: RNA chain is synthesized in 5’-3’ direction.

Termination: A termination factor (ρ factor) binds to the RNA polymerase and terminates the transcription.

2018 SAY


1.   'Human genome project is a mega project" Give two reasons to explain this. (2)

ü Answer:

It was a 13-year long project.

It has sequenced 3 x 109 bp in human genome with the help of computer.

It has identified about 30,000 genes in human genome.

2.   Observe the diagram and answer the following questions: (2)


a.      Identify the diagram.

b.     Name the enzymes A, B and C.


ü Answer:


(a) Lac operon.

(b) A= beta galactosidase, B= Permease, C= Transacetylase.


3.   "Genetic code is universal in nature"

a.      Substantiate this statement.

b.     Mention any two other salient features of genetic code. (2)


ü Answer:


(a) It means from bacteria to human, each triplet codon codes for the same amino acid.

(b) Genetic code is unambiguous.

Genetic code is degenerate.


4.   Expand the following: (3)

a.      SNP

b.     BAC

c.      YAC


ü Answer:


(a) Single Nucleotide Polymorphism

(b) Bacterial Artificial Chromosome

(c) Yeast Artificial Chromosome.


2018 MARCH


1.  Expressed sequences in the gene are called (1)

            (a) Introns                         (b) Mutons         

(c) Exons                          (d) Cistrons


ü Answer:

(c) Exons


2.   DNA is tightly packed structure and is found as units called nucleosomes. (2)

(a)   Explain the concept of nucleosomes.

(b)   Differentiate between euchromatin & heterochromatin.


ü Answer:


(a) Negatively charged DNA is wrapped around positively charged histone octamer to form nucleosome.

(b) • Euchromatin: Loosely packed and transcriptionally active region of chromatin.

Heterochromatin: Densely packed and inactive region of chromatin.


3.   Identify the disadvantages of RNA over DNA as a genetic material and explain it. (2)


ü Answer:


It is catalytic and hence reactive. It is single stranded and has 2’-OH group in sugar. So RNA is less stable and mutate faster.


4.  (a) In lac Operon lactose act as inducer molecule. Evaluate the statement and explain it.

(b) Observe the diagram of lac Operon and identify labelled parts A, B, C and D. (3)



ü Answer:


(a) The statement is true. Lactose switches on the lac operon system inducing the action of structural genes.

(b) A= Repressor mRNA, B= b-galactosidase, C= Permease D= Transacetylase.

 


No comments:

Post a Comment