Tuesday, October 27, 2020

2020 March | HSE +2 Exam | Zoology Question Paper

 2020 MARCH (+2)

PART B: ZOOLOGY

Answer any 3 questions from 1 - 5. Each carries 1 score.

1.       From the following, find out the symbol used in the human pedigree analysis representing male.

2.       Name the technique of transferring embryos up to 8 blastomeres into the fallopian tube.

a.       GIFT

b.       ZIFT

c.       ICSI

d.       IUI

3.       Microbe which help in the production of Biogas.

a.       Aspergillus niger

b.       Trichoderma polysporum

c.       Saccharomvces cerevisiae

d.       Methanobacterium

4.       Which of the following human ancestor is more 'ape' like?

a.       Homo habilis

b.       Dryopithecus

c.       Australopithecines

d.       Homo erectus

5.       Select the cause of extinction of Cichlid fish in Lake Victoria of East Africa.

a.       Habitat loss and fragmentation

b.       Over-exploitation

c.       Alien species invasions

d.       Co-extinctions

Answer any 9 questions from 6 - 16. Each carries 2 scores. (9 x 2 = 18)

6.       Some examples of microbes in human welfare are given. Classify them under the headings given below.

[Egs: Rhizobium, Propionibacterium sharmanii, Azaspirillum, Lactic acid bacteria, Anabaena, Azotobacter, Aspergillus niger Saccharomyces cerevisiae...]

Microbes in Household Products

Microbes as Bio-fertilizers

 

 

7.       Observe the figure given below showing Mendel's experiment using pea plants.

a.       Identify the cross.

b.       Which are the laws proposed by Mendel based on these observations?

8.       "All copulations lead to fertilization and pregnancy". Do you agree with this statement? Justify your answer.

9.       Fill the blanks in Column A and B using appropriate terms.

Theory

Scientists

(a)    Theory of natural selection

A

(b)    Use and disuse of organs

B

(c)    Theory of mutation

C

(d)    Theory of spontaneous generation

D

10.   One of the salient features of genetic code is "Universal".

a.       Write any other two salient features of Genetic code.

b.       Which is the initiator codon? And name the amino acid it codes.

11.   Amniocentesis for sex determination is legally banned now.

a.       What is amniocentesis?

b.       Why it is banned?

12.   Name any two protozoan diseases, its causative organism and any two symptoms.

13.   Tropical Amazonian rainforest in South America has the greatest biodiversity on earth. Do you agree with this? Explain.

14.   Complete the illustration chart given below.



15.   Correct the following statements, if there is any mistake:

a.       Haemophilia is an autosome linked recessive disease.

b.       Turner's syndrome is due to the presence of an additional copy of X chromosome.

16.   p2 + 2pq + q2 = 1 denotes an evolutionary principle.

a.       Name the principle.

b.       Mention any three factors affecting this.

Answer any 3 questions from 17 - 20. Each carries 3 score. (3 x 3 = 9)

17.   Observe the figure given below:


a.       Identify the process in the picture.

b.       Name any two enzymes needed for this process.

c.       Write the peculiarities of the newly synthesized daughter strands.

18.   Explain the measures useful for prevention and control of alcohol and drugs abuse among adolescents.

19.   The graph given below shows the level of the ovarian hormones in a normally menstruating woman during the follicular phase.



a.       Name 'A' and 'B'.

b.       Reconstruct the graph showing the level of hormones in luteal phase.

c.       Name the hormone secreted by Corpus Luteum and mention its function.

20.   A DNA sequence is provided below.

5' - ATGCATGCATGCATGCATGCATGCAT - 3'

a.       Write down the sequence of its complementary strand.

b.       Name the enzyme involved in transcription of DNA.

c.       What would happen if both the strands of the DNA act as templates for transcription?

No comments:

Post a Comment