Tuesday, October 27, 2020

2020 March | HSE +2 Exam | Zoology - Answers

 ZOOLOGY (2020 March)

ANSWERS

1.     (c) ¨

2.     (b) ZIFT

3.     (d) Methanobacterium

4.     (b) Dryopithecus

5.     (c) Alien species invasions

6.      

Microbes in Household Products

Microbes as Bio-fertilizers

Propionibacterium sharmanii

Lactic acid bacteria

Saccharomyces cerevisiae

Aspergillus niger

Rhizobium

Azospirillum

Azotobacter

Anabaena

7.     (a) Monohybrid cross

  (b) Law of Dominance, Law of Segregation.

8.     No. Fertilization happens only if ovum & sperms are transported simultaneously. So all copulations do not lead to fertilization & pregnancy.

9.     A= Charles Darwin

  B= Lamarck

  C= de Vries

  D= Aristotle / Louis Pasteur.

10.   (a) Genetic code is degenerate.

Genetic code is unambiguous.

  (b) Initiator codon: AUG

Name of amino acid it codes: Methionine.

11.   (a) Amniocentesis is a test in which amniotic fluid of the foetus is taken to analyse the foetal cells to test the presence of genetic disorders, survivability of the foetus etc.

(b) It is misused for finding out the sex of the embryo.

12.   Protozoan disease 1: Malaria

Causative organism: Plasmodium sp.

Symptoms: Chill and high fever.

Protozoan disease 2: Amoebiasis.

Causative organism: Entamoeba histolytica.

Symptoms: Constipation, abdominal pain.

13.   Yes. I agree.

Tropical Amazonian rainforest has the greatest species richness. It contains > 40000 plant species, > 5000 vertebrates and > 1,25,000 species of invertebrates. This is because tropical regions have constant environment and gets more solar energy.

14.   (a) Opioids

  (b) Stimulates CNS.

  (c) Papaver sominferum (Poppy plant)

  (d) Cannabis sativa (Hemp plant)

15.   (a) Haemophilia is a sex linked recessive disease.

Or

Sickle cell anaemia is an autosome linked recessive disease.

  (b) Turner's syndrome is due to the absence of an X chromosome

Or

  Klinefelter’s syndrome is due to the presence of an additional copy of an X chromosome.

16.   (a) Hardy – Weinberg Principle.

  (b) Gene migration, Genetic drift, Mutation etc.

17.   (a) DNA replication.

  (b) DNA polymerase, DNA ligase, Helicase etc.

  (c) One strand is formed as continuous strand (leading strand). Other strand is formed as small stretches (Okazaki fragments).

18.   Avoid undue peer pressure.

Education and counselling.

Seeking help from parents and peers.

Looking for danger signs.

Seeking professional and medical help.

19.   (a) A= Progesterone, B= Estrogen.

(b)

(c) Hormone: Progesterone.

Function: Maintains endometrium/ pregnancy.

20.   (a) 3' – TACGTACGTACGTACGTACGTACGTA – 5’

  (b) DNA dependent RNA polymerase.

  (c) It results in the production of 2 RNA molecules simultaneously. This would be complimentary to each other. It forms a double stranded RNA and prevents translation.

No comments:

Post a Comment