Plus Two Biology (Bot + Zoo) | Practice Model Question Paper PDF with Answer key | SET 3

👉 Download Biology Question Paper PDF - SET 3

PART A: BOTANY

I. Answer any 3 questions from 1 – 5. Each carries 1 score. (3 x 1 = 3)

1) Note the relationship between first two words and fill up the fourth place.

Number of births in the population during a given period: Natality

Number of deaths in the population during a given period: ………………

✅ Mortality.

2) The capacity to generate a whole plant from any cell/explant is called …………...

✅ Totipotency.

3) Restriction enzymes belong to a larger class of enzymes called nucleases. These are of two kinds such as ………… and …………….

✅ Endonucleases and Exonucleases.

4) Label the parts A and B in the given figure.

✅ A= Vegetative cell      B= Generative cell.

5) Expand the abbreviation GPP.

✅ Gross Primary Productivity.

II. Answer any 9 questions from 6 – 16. Each carries 2 scores. (9 x 2 = 18)

6) Consider pond as an ecosystem showing the number of individuals in the following categories.

Carnivores- 2500, Producers- 15000, Herbivores- 5000

a. Draw the pyramid of numbers in this ecosystem.

b. Comment on the energy flow in the ecosystem.

✅ Answer

(a) Pyramid of numbers.

(b) Energy in an ecosystem flows from producers to herbivores and then to carnivores. With each transfer, some energy is lost as heat. This results in fewer carnivores than herbivores or producers.

7) Genetically Modified Organism (GMO) is always a debatable topic among scientists, academicians and public. State any four advantages of GMOs.

✅ Answer

Advantages of GMOs:

• It makes crops more tolerant to abiotic stresses.

• Pest-resistant crops reduce the use of chemical pesticides.

• It reduces post-harvest losses.

• It increases efficiency of mineral usage by plants.

• It enhances nutritional value of food. E.g. Golden rice.

8) A picture showing transverse section of a young anther is given below. Label A to D.

✅ Answer

A= Connective

B= Endothecium

C= Sporogenous tissue

D= Tapetum

9) Bt toxin is produced by Bacillus thuringiensis that can kill certain insects.

a. Name the bacterial gene that is producing this toxin.

b. Why the toxin produced by the bacterium is non-toxic to it?

✅ Answer

a) Cry gene.

b) The Bt toxin is non-toxic to the bacterium itself because it is produced in an inactive form called a protoxin. It only becomes active in the alkaline gut of certain insects.

10) Ecological pyramids are usually upright. Meanwhile some pyramid of biomass is inverted. Explain the reason.

✅ Answer

Inverted pyramid of biomass occurs when the standing crop (biomass) of primary consumers (herbivores) is higher than the standing crop of producers (plants). It is commonly observed in aquatic ecosystems where phytoplankton (producers) grow and get replaced quickly. This allows a larger group of zooplankton (primary consumers).

11) What is Biopiracy? Explain with an example.

✅ Answer

Biopiracy is the use of bio-resources by multinational companies and other organizations without proper authorization from the countries and people concerned.

Certain companies have got patents for products and technologies that make use of the genetic materials, plants etc. that have been identified, developed and used by farmers and indigenous people of a country. E.g. Basmati rice, herbal medicines (turmeric, neem etc.).

12) Population interactions may be beneficial or harmful. Briefly explain any two interactions with examples.

✅ Answer

Mutualism: It is a beneficial interaction where both species get benefit. E.g., Bees and flowering plants. The plants benefit from pollination, and bees get nectar.

Predation: It is an interaction where one organism (predator) is benefitted and other organism (prey) is harmed. E.g., Lions preying on zebras.

13) After fertilization in flowering plants, seeds bearing embryos are found inside the fruits.

a. Name the parts that give rise to embryo and fruits.

b. What is the thick wall of the fruit that is protective in function called?

✅ Answer

a. The zygote gives rise to the embryo.

The ovary develops into the fruit.

b. Pericarp.

14) Distinguish between GFC and DFC.

✅ Answer

Grazing Food Chain (GFC): Here, primary consumer feeds on living plants (producer).

E.g. Grass (producer) → Goat (primary consumer) → Man

Detritus Food Chain (DFC): Here, primary consumer feeds on dead organic matter (detritus). Death of organism is the beginning of the DFC.

15) Recombinant DNA technology can be accomplished only if we have the following key tools i.e. Restriction enzymes. Polymerase enzyme, Ligases and Vectors. State the functions of

(a) Ligases          (b) Restriction enzymes

✅ Answer

(a) Ligases: They help to link DNA strands together. They are used in recombinant DNA technology to connect the desired gene to the vector.

(b) Restriction enzymes: These are DNA-cutting enzymes that recognize specific sequences in DNA. It helps in determining the location at which the desired gene is inserted into the vector genome.

16) Briefly explain Brood parasitism in birds.

✅ Answer

Brood parasitism in birds:

Here, the parasitic birds lay eggs in the nest of its host and lets the host incubate them.

During evolution, eggs of the parasitic bird have evolved to resemble the host’s egg in size and colour. So the host bird cannot detect and eject the foreign eggs easily.

E.g. Brood parasitism between cuckoo and crow.

III. Answer any 3 questions from 17 – 20. Each carries 3 scores. (3 x 3 = 9)

17) (a) One of the speakers in the National Children’s Science Congress delivered a talk about Transgenic animals. Explore any 2 benefits of transgenic animals.

(b) Expand ELISA.

✅ Answer

(a) 2 benefits of transgenic animals:

• To study regulation of genes and their action on normal physiology & development: E.g. Study of insulin-like growth factor. Genes (from other species) that alter formation of this factor are introduced and the biological effects are studied. This gives information about biological role of the factor.

• To study the contribution of genes in the development of a disease and thereby new treatments: E.g. transgenic models for human diseases such as cancer, cystic fibrosis, rheumatoid arthritis & Alzheimer’s.

(b) Enzyme Linked Immuno-Sorbent Assay.

18) Transfer of pollen grains from the anther to the stigma of a flower is called pollination. Grass plants generally have small, inconspicuous flowers while plants belonging to many angiosperm families bear conspicuous coloured flowers.

a. Comment on the type of pollination taking place in these two groups.

b. What are the salient features present in these two groups for effective pollination?

✅ Answer

a. Grass plants undergo Anemophily (wind pollination).

Angiosperms with conspicuous, coloured flowers undergo entomophily (insect pollination) and ornithophily (bird pollination).

b. For grass plants:

• The flowers produce enormous amount of pollen.

• Pollen grains are light and non-sticky.

• They often possess well-exposed stamens.

• Large, feathery stigma to trap air-borne pollen grains.

For Angiosperms with conspicuous, coloured flowers:

• Large, colourful, fragrant and rich in nectar.

• The pollen grains are generally sticky.

• Small flowers form inflorescence to make them visible.

19) Given below is the bar diagram showing age structure of three different populations. Observe the diagram carefully and answer the following questions.

a. Identify the types of populations A, B and C.

b. Give a brief account of age pyramids.

✅ Answer

a) A= Expanding population, B = stable population C= Declining population.

b) If the age distribution in a population is plotted for the population, the resulting structure is called an age pyramid. For human population, the age pyramids generally show age distribution of males and females in a diagram. The shape of the pyramids reflects the growth status of the population - whether it is growing, stable or declining.

20) The below picture shows cloning vector pBR322.

a. What is ori? Mention its importance.

b. How does the insertion of foreign DNA at Bam HI site select?

c. How many cloning sites are depicted in this vector as shown in the figure?

✅ Answer

a) ori is a sequence where replication starts.

Importance: A piece of DNA linked to ori can replicate within the host cells. This also controls the copy number of linked DNA. So, for getting many copies of the target DNA, it should be cloned in a vector whose origin support high copy number.

b) In vector pBR322, foreign DNA is ligated at Bam H I site of tetracycline resistance gene. As a result, recombinant plasmid is formed.

c) Eight cloning sites.

PART B: ZOOLOGY

I. Answer any 3 questions from 1 – 5. Each carries 1 score. (3 x 1 = 3)

1) Observe the diagram below:

Which among the following is the complimentary sequence of the DNA fragment shown above?

a. 5’ → ATTCG → 3’

b. 3’ → ATTCG → 5’

c. 3’ → TAAGC → 5’

d. 3’ → CGAAT → 5’

✅ c. 3’ → TAAGC → 5’

2) One among the contraceptive method is peculiar. Find the odd one. What is common among others?

a. Periodic abstinence

b. Coitus interruptus

c. Lactational amenorrhea

d. IUDs

✅ IUDs. Others are natural contraceptive methods.

3) The process of fusion of a sperm with ovum is called ………….

✅ Fertilization

4) Which of the following is not a Mendelian disorder?

Colour blindness, Down’s syndrome, Haemophilia, Thalassemia

✅ Down’s syndrome

5) Identify the disease shown in the following figure and write the causative organism of the disease.

✅ Filariasis. Causative organism is Wuchereria bancrofti.

II. Answer any 9 questions from 6 – 16. Each carries 2 scores. (9 x 2 = 18)

6) The sequence of template strand of a gene is given below.

3’ CACGTGGACTGAGGACTCCTC 5’

Construct the base sequence of mRNA transcribed from this.

✅ Answer

5’ GUGCACCUGACUCCUGAGGAG 3’

7) a) Arrange the given chemical compounds in the sequential order as per the concept of origin of life.

(Ammonia, Hydrogen, Protein, Nucleic acid, Amino acid)

b) Correlate Miller’s experiment with this.

✅ Answer

a) Hydrogen → Ammonia → Amino acid → Protein → Nucleic acid

b) Miller’s experiment simulated early Earth conditions and produced simple organic compounds like amino acids. It proves theory of chemical evolution.

8) Make pairs by putting the related items together stating their relationship.

Monascus purpureus, Trichoderma polysporum, Ethanol, Blood clot, Streptokinase, Statin, Saccharomyces cerevisiae, Cyclosporine

✅ Answer

Monascus purpureus – Statin

Trichoderma polysporum – Cyclosporine

Saccharomyces cerevisiae – Ethanol

Streptokinase - Blood clot

9) The treatment facility advertised on the brochure of a private clinic is shown below.

IVF      ZIFT      GIFT      IUI

a. Can you suggest what type of a clinic it is?

b. Expand any three of them.

✅ Answer

a. Fertility clinic to treat Infertility.

b. IVF: In-Vitro Fertilization

ZIFT: Zygote Intrafallopian Transfer

GIFT: Gamete Intrafallopian Transfer

IUI: Intrauterine Insemination

10) Lakshmi and Sujitha are two nursery students. Sujitha gets common cold very often. Lakshmi not.

a. How do you interpret this in an immunological aspect?

b. What are the common barriers protecting Lakshmi from cold?

✅ Answer

a) Immunologically, Lakshmi has a stronger immune system or better immunity against the common cold virus.

b) Common barriers protecting Lakshmi.

     • Intact skin as a physical barrier.

     • Mucous membranes in the respiratory tract trapping pathogens.

     • Presence of antimicrobial substances in tears and saliva.

11) A bacterial infection was effectively controlled by using a specific antibiotic for a long time. But now- a- days this antibiotic is not found to be so effective to control the said infection. Give a scientific explanation for this phenomenon based on evolution.

✅ Answer

This phenomenon is an example for natural selection by anthropogenic action. Over time, bacteria can evolve through natural selection to become resistant to antibiotics. This happens when some bacteria survive the antibiotic treatment due to genetic mutations. These bacteria multiply, leading to a population of antibiotic-resistant bacteria.

12) After analyzing the karyotype of a short statured round headed person with mental retardation, a general physician noticed an addition of autosomal chromosome.

Answer the following questions.

a. Addition or deletion of chromosome generally results in ………………….

b. What may be the possible syndrome or disorder the above person should suspected to be?

c. Suggest two more morphological peculiarities to confirm the chromosome disorder in that person.

✅ Answer

a. Chromosomal disorders

b. Down’s syndrome

c. Flattened face, Simian palm crease, partially open mouth, furrowed tongue etc.

13) Analyzing the relationship among different columns, fill the gap appropriately.

✅ Answer

(a) Typhoid

(b) Nasal congestion & discharge

(c) Plasmodium species

(d) Malaria.

14) A couple has 2 daughters. The blood group of husband and wife is ‘O’.

a. What are the possible blood groups the children should have?

b. Whether any change in blood group will occur if they have two sons instead of daughters? Substantiate your answer.

✅ Answer

a) The children will be ‘O’ blood group. This is because ‘O’ blood type is recessive and doesn’t have any antigens.

b) The sex of the children does not affect their blood group. Blood group inheritance is independent of sex. So, if the couple has two sons instead of daughters, the sons would also have ‘O’ blood type.

15) It is evident that, it is the genetic make-up of the sperm that determine the sex of the child in human beings. Substantiate.

✅ Answer

In humans, sex is determined by the X and Y chromosomes. Females have two X chromosomes (XX) and males have one X and one Y chromosome (XY).

During reproduction, a female can only pass on an X chromosome through her egg, while a male can pass on either an X or a Y chromosome through his sperm.

Therefore, if the sperm carries an X chromosome, the child will be female (XX). If the sperm carries a Y chromosome, the child will be male (XY).

16) The below graph shows the levels of ovarian hormones in a normally menstruating woman during the follicular phase.

a. Name a & b.

b. Mention the role of pituitary hormones in maintaining this condition.

✅ Answer

a. (a) is estrogen & (b) is progesterone.

b. During follicular phase, pituitary gland secretes Follicle Stimulating Hormone (FSH) which stimulates the growth of ovarian follicles and secretion of estrogen. The pituitary gland also secretes Luteinizing Hormone (LH), but its level is low during this phase, resulting in low progesterone levels.

III. Answer any 3 questions from 17 – 20. Each carries 3 scores. (3 x 3 = 9)

17) a) Draw a flowchart showing the process of spermatogenesis. (2)

b) What is meant by Spermiation? (1)

✅ Answer

a) Flowchart showing spermatogenesis.

b) After spermiogenesis, sperm heads are embedded in Sertoli cells to get nourishment. Then the matured sperms are released from the seminiferous tubules. It is called spermiation.

18) Categorize the given birth control methods into three groups with proper heads.

Cervical caps, Vasectomy, CuT, Tubectomy, Diaphragms, Condoms, Lippes loop

✅ Answer

Types of Contraceptives:

Barrier Methods: Cervical caps, Diaphragms, Condoms.

Surgical Methods: Vasectomy, Tubectomy.

Intrauterine Devices (IUDs): CuT, Lippes loop.

19) “Biodiversity is the rich variety of life that makes our world a thriving and beautiful tapestry of different plants, animals, and ecosystems, working together in harmony.”

a. Point out the levels of diversity in nature. (1)

b. Give a brief description about “The Evil Quartet.” (2)

✅ Answer

a) Genetic diversity, Species diversity & Ecological diversity.

b) The Evil Quartet refers to the four major causes of biodiversity losses. They are

• Habitat loss and fragmentation

• Overexploitation

• Alien species invasions

• Coextinction

20) In a paternity dispute, the VNTR DNA samples of parent and child were DNA fingerprinted. The diagrammatic representation of the DNA fingerprint is shown below.

a. What is your opinion about the paternity of child? Substantiate your opinion. (1)

b. List down any four major steps of molecular biological procedures adopted for this. (2)

✅ Answer

a. It suggests that the individual is the biological parent of the child. DNA fingerprinting is a method for determining paternity. If the VNTR patterns of the child match the alleged parent’s patterns, it provides strong evidence of paternity.

b. Steps of DNA fingerprinting:

• Isolation of DNA.

• Digestion of DNA by restriction endonucleases.

• Separation of DNA fragments by gel electrophoresis.

• Transferring (blotting) DNA fragments to synthetic membranes such as nitrocellulose or nylon.

• Hybridization using radioactive labelled VNTR probe.

• Detection of hybridized DNA by autoradiography.

👉 Other Question Papers

👉 Exam Special Materials