tag:blogger.com,1999:blog-68236713944824926132024-03-19T13:00:25.483+05:30Everything you need to learn Biology and ScienceAbu Raniyahttp://www.blogger.com/profile/14189496606355139812noreply@blogger.comBlogger1758125tag:blogger.com,1999:blog-6823671394482492613.post-27102061864692975452024-03-18T12:45:00.062+05:302024-03-18T15:10:15.490+05:30Plus One Biology (Bot + Zoo) | Practice Model Question Paper PDF with Answer key | SET 2<!DOCTYPE html>
<html>
<head>
<title>Example Webpage</title>
<style>
body {
user-select: none; /* Prevent selection of text */
-moz-user-select: none; /* Firefox */
-webkit-user-select: none; /* Safari and Chrome */
-ms-user-select: none; /* Internet Explorer/Edge */
}
h1 {
user-select: text; /* Allow selection of title */
}
</style>
</head>
<p style="font-size: 25px; font-family: Arial; text-align: center; color: #2068d4; line-height: 1.5;"> <b> π <a href="https://drive.google.com/file/d/1FXCXguPyvaqiUWeoIvSe4qSUMgCekB76/view?usp=drive_link" target="_blank">Download Biology Question Paper PDF - SET 2</a> </b> </p>
<style>
/* Customize the box style */
.box {
background-color: #ffffff;
border: 1px solid #ffffff;
border-radius: 1px;
padding: 10px;
margin-bottom: 10px;
margin-right: -14px;
margin-left: -14px;
}
/* Customize the question style */
.question {
font-size: 17px;
font-weight: bold;
color: #3D4849;
font-family: Open Sans;
margin-bottom: 10px;
}
/* Customize the answer style */
.answer {
font-size: 18px;
font-weight: normal;
font-family: Roboto;
margin-bottom: 10px;
background-color: #e7ffde;
}
/* Hide the answer by default */
.answer {
display: none;
}
/* Customize the view/hide answer button */
.answer-button {
background-color: #4CAF50;
border: none;
border-radius: 5px;
color: white;
padding: 8px 16px;
text-align: center;
text-decoration: none;
display: inline-block;
font-size: 18px;
margin-bottom: 1px;
cursor: pointer;
}
/* Style the button differently when it changes to "Hide Answer" */
.answer-button.hide-answer {
background-color: #f44336;
}
/* Show the answer when the visible class is added */
.answer.visible {
display: block;
}
.table-text {
display: grid;
grid-template-columns: 50% 50%;
grid-gap: none;
margin-top: 5px;
border-collapse: collapse;
}
.table-text-2 {
display: grid;
grid-template-columns: 33.33% 33.33% 33.33%;
grid-gap: none;
margin-top: 5px;
border-collapse: collapse;
}
.table-text-header,
.table-text-cell {
padding: 5px;
border: 1px solid black;
text-align: left;
}
.table-text-header {
font-weight: bold;
text-align: center;
}
.no-break {
white-space: nowrap;
}
.tab {
text-indent: 40px; /* Adjust the value as per your preference */
}
blockquote {
background: none; /* Remove background color */
border: none; /* Remove border */
margin: 0; /* Remove default margin */
padding: 0 0 0 20px; /* Retain padding on the left side */
quotes: none; /* Remove quote marks */
}
blockquote:before {
content: none; /* Remove quote marks */
}
</style>
<p style="font-size: 30px; font-family: Arial; text-align: center; color: #0c8a7d; background-color: #a2f5d3; padding: 10px;"> <b> PART A: BOTANY </b></p>
<p style="font-size: 18px; font-family: Arial; text-align: left; color: #5c5c5c; background-color: #ebeaec; padding: 10px;"> <b> <i>I. Answer any 3 questions from 1 β 5. Each carries 1 score. (3 x 1 = 3)</i> </b> </p>
<div class="box">
<div class="question">1) Which among the following is an example for flagellated protozoan? <p> a. <i>Amoeba</i> b. <i>Paramoecium</i> <p> c. <i>Trypanosoma</i> d. <i>Plasmodium</i> </div>
<div class="answer"><p>β
c) <i>Trypanosoma</i> </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question">2) The type of inflorescence in which main axis continues to grow is β¦β¦β¦β¦β¦β¦. </div>
<div class="answer"><p>β
Racemose inflorescence </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question">3) A simple gaseous Plant Growth Regulator (PGR) is .................. </div>
<div class="answer"><p>β
Ethylene </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> 4) Sometimes, a few epidermal cells, in the vicinity of the guard cells become specialised in their shape and size and are known as β¦β¦β¦β¦β¦β¦. </div>
<div class="answer"> <p>β
Subsidiary cells </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question">5) Crossing over occurs in ............. substage of Prophase-I. <p> a. Leptotene b. Zygotene <p> c. Diplotene d. Pachytene </div>
<div class="answer"><p>β
d. Pachytene </div>
<button class="answer-button">View Answer</button>
</div>
<p style="font-size: 18px; font-family: Arial; text-align: left; color: #5c5c5c; background-color: #ebeaec; padding: 10px;"> <b> <i>II. Answer any 9 questions from 6 β 16. Each carries 2 scores. (9 x 2 = 18)</i> </b> </p>
<div class="box">
<div class="question"> 6) Plants that are adapted to dry tropical regions have the C4 pathway. Write any two advantages of C4 plants over C3 plants. </div>
<div class="answer"> <p>β
<b>Answer</b></p> Tolerate high temperature, Lack of photorespiration, Kranz anatomy etc. </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> 7) <i>RuBisCO</i> is the most abundant enzyme in the plant world. How does <i>RuBisCO</i> involve in photorespiration? </div>
<div class="answer"> <p>β
<b>Answer</b></p> Oxygen binds with <i>RuBisCO</i> and breaks RuBP into one molecule of phosphoglycerate and phosphoglycolate. </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> 8) a) Bryophytes are called amphibians of plant kingdom. Give reason. <p> b) Mention any two divisions of bryophytes. </div>
<div class="answer"> <p>β
<b>Answer</b></p> a) Bryophytes live in moist soil and they need water for sexual reproduction. <p> b) Liverworts and mosses. </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> 9) "There are several reasons why plants can get along without respiratory organs." Justify the above statement by citing two reasons. </div>
<div class="answer"> <p>β
<b>Answer</b></p> Each plant part takes care of its own gas exchange needs. <p> Plants do not have great demands for gas exchange. </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> 10) Many plants show plasticity during their life span. <p> a. What is plasticity? <p> b. Give one example. </div>
<div class="answer"> <p>β
<b>Answer</b></p> (a) Plasticity is a phenomenon in which plants follow different pathways in response to environment or phases of life to perform different kind of structures. <p> (b) Phenomenon of heterophylly in cotton, coriander, larkspur, or buttercup. </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> 11) Glycolysis is the breakdown of glucose into pyruvic acid. <p> a. Where does glycolysis occur in a cell? <p> b. Why is glycolysis a partial oxidation? </div>
<div class="answer"> <p>β
<b>Answer</b></p> (a) Cytoplasm <p> (b) Glucose undergoes partial oxidation to form two molecules of pyruvic acid. </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> 12) Given below is the diagrammatic representation of a particular stage of mitosis: <div class="separator" style="clear: both;"><a href="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEjA_Apihyphenhyphen98klZIJoRNc92Rn4pUZwUWkIw-h7JZeeHVVA1FsAwqhzLsg98nc4F5HVFdfQDKyeYnrGs8_zGL0v848aE-ZAL95VaEfDYDpZItq59SrriNgzN6C3zmxC70UvUZ5iQw48ma3-_pPl2M0syls1mgkAT85eEj1iJq6kujG_63Yi-5hjLFmf5-IG8/s272/bob.jpg" style="display: block; padding: 0; text-align: center; "><img alt="" border="0" height="400" data-original-height="272" data-original-width="231" src="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEjA_Apihyphenhyphen98klZIJoRNc92Rn4pUZwUWkIw-h7JZeeHVVA1FsAwqhzLsg98nc4F5HVFdfQDKyeYnrGs8_zGL0v848aE-ZAL95VaEfDYDpZItq59SrriNgzN6C3zmxC70UvUZ5iQw48ma3-_pPl2M0syls1mgkAT85eEj1iJq6kujG_63Yi-5hjLFmf5-IG8/s400/bob.jpg"/></a></div> <p> a. Identify the stage. <p> b. Write any two features of this stage. </div>
<div class="answer"> <p>β
<b>Answer</b></p> (a) Anaphase <p> (b) Centromere split and chromatids separate. Chromatids move to opposite poles. </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> 13) Draw the given flow chart in your answer sheet. Fill the blank columns. <div class="separator" style="clear: both;"><a href="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEhXBhph7wg1sS-R-bKfv3xKdxTnTygkeqktmxoPN6yo3cJE0e7Ckk7gJ9jPlqMWFR-Q8SpoRf22m4qOcyhFtqkrQRK3x4nURe2m6UNfdwOjOn_f15E-JB5LITzVXqELWM6g9Ad32aqKFGVFyeq9uL291tjTHNnnXTRjM-83UKgGMpQcPPEvODY4j9Dcx3U/s1600/bob2.png" style="display: block; padding: 0; text-align: center; "><img alt="" border="0" data-original-height="154" data-original-width="450" src="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEhXBhph7wg1sS-R-bKfv3xKdxTnTygkeqktmxoPN6yo3cJE0e7Ckk7gJ9jPlqMWFR-Q8SpoRf22m4qOcyhFtqkrQRK3x4nURe2m6UNfdwOjOn_f15E-JB5LITzVXqELWM6g9Ad32aqKFGVFyeq9uL291tjTHNnnXTRjM-83UKgGMpQcPPEvODY4j9Dcx3U/s1600/bob2.png"/></a></div> </div>
<div class="answer"> <p>β
<b>Answer</b></p> <div class="separator" style="clear: both;"><a href="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEjln1-ybmfFY58ff1K07Bt1XlRY3S6fEv2jbTqmXNRzH-otE0vJaGW_CMJwVJ6-krVg4SjkMf_FgCLjF2EZq0pTZSRSGCmSRUZ3MUj0XF9yx_XttOYKx2_g_SKozda4Q5-cJ5j_j30hwBKqQ5AOvI05rF-z1UKFkoxuF9Znxwypx5ztSOQnRfH45L_8EtU/s1600/bob2.png" style="display: block; padding: 0; text-align: center; "><img alt="" border="0" data-original-height="199" data-original-width="400" src="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEjln1-ybmfFY58ff1K07Bt1XlRY3S6fEv2jbTqmXNRzH-otE0vJaGW_CMJwVJ6-krVg4SjkMf_FgCLjF2EZq0pTZSRSGCmSRUZ3MUj0XF9yx_XttOYKx2_g_SKozda4Q5-cJ5j_j30hwBKqQ5AOvI05rF-z1UKFkoxuF9Znxwypx5ztSOQnRfH45L_8EtU/s1600/bob2.png"/></a></div> </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> 14) (a) Define Mycorrhiza. <p> (b) How is Mycorrhizal association helpful to plants? </div>
<div class="answer"> <p>β
<b>Answer</b></p> (a) <i>Mycorrhiza</i> is the symbiotic association of fungus and roots of higher plants. <p> (b) It helps plants for absorbing minerals from the soil.
</div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> 15) Match the columns A and B. <div class="separator" style="clear: both;"><a href="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEgDGEDFE8iYDQycnfXXEieE9VvOg-k85Ok6659PtlSgl-yKQkHrwtwipE3noydVn5WYoMd4lXwbyj2bFselVWHucEP33fA5g5K9LR_xnTKElgKsc7aS_3lB4lnkLenSG5fNkSZHa__75iTBtRfEZrwGOupdqP8eeVL1svhabgNYYWu-oBSU4R_XK3HHOAU/s1600/bob2.png" style="display: block; padding: 0; text-align: center; "><img alt="" border="0" data-original-height="146" data-original-width="450" src="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEgDGEDFE8iYDQycnfXXEieE9VvOg-k85Ok6659PtlSgl-yKQkHrwtwipE3noydVn5WYoMd4lXwbyj2bFselVWHucEP33fA5g5K9LR_xnTKElgKsc7aS_3lB4lnkLenSG5fNkSZHa__75iTBtRfEZrwGOupdqP8eeVL1svhabgNYYWu-oBSU4R_XK3HHOAU/s1600/bob2.png"/></a></div> </div>
<div class="answer"> <p>β
<b>Answer</b></p> <div class="separator" style="clear: both;"><a href="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEhNhXnW1U_mdr-GZzzhPxiHhyphenhyphenYmRRnNQhtzuLwoK44XkIYYXn0MS5UrPq08mIVn9VYnLLKro6awgtd1END3-qoLBNcfS055WHQBFi8JB3vcTPc-vK4hR3bALF1gaNVId2Ie618_t_RiRJfcaAJSbkVo7mTebpHN6FDueSo7NRGw74Qe1O1sbmEbS90ubMs/s1600/bob2.png" style="display: block; padding: 0; text-align: center; "><img alt="" border="0" data-original-height="126" data-original-width="450" src="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEhNhXnW1U_mdr-GZzzhPxiHhyphenhyphenYmRRnNQhtzuLwoK44XkIYYXn0MS5UrPq08mIVn9VYnLLKro6awgtd1END3-qoLBNcfS055WHQBFi8JB3vcTPc-vK4hR3bALF1gaNVId2Ie618_t_RiRJfcaAJSbkVo7mTebpHN6FDueSo7NRGw74Qe1O1sbmEbS90ubMs/s1600/bob2.png"/></a></div> </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> 16) (a) Fill the blanks in the flowchart given below. <div class="separator" style="clear: both;"><a href="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEhXtME65SMxVXFGnkGJbei3hakMcZgU4mLbmbLn3yjb4S_p9t2mHFIS1eMKb8LqVVCCkausN0nNw0SyPNd9yWYYHxE1G1koQ42c_CFabB1hdw4RWnVxGjJy7tsCUjIneaNRJqE6aODrmcXTrNGNNF1UQ3ccXtLouel5dPeAI3vXolR4d-zGLWk91sCOF1k/s1600/bob.jpg" style="display: block; padding: 0; text-align: center; "><img alt="" border="0" data-original-height="227" data-original-width="715" src="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEhXtME65SMxVXFGnkGJbei3hakMcZgU4mLbmbLn3yjb4S_p9t2mHFIS1eMKb8LqVVCCkausN0nNw0SyPNd9yWYYHxE1G1koQ42c_CFabB1hdw4RWnVxGjJy7tsCUjIneaNRJqE6aODrmcXTrNGNNF1UQ3ccXtLouel5dPeAI3vXolR4d-zGLWk91sCOF1k/s1600/bob.jpg"/></a></div> (b) Which organelle possesses hydrolytic enzymes?
</div>
<div class="answer"> <p>β
<b>Answer</b></p> (a) Endoplasmic reticulum (ER), Golgi complex, Vacuoles. <p> (b) Lysosomes possesses hydrolytic enzymes. </div>
<button class="answer-button">View Answer</button>
</div>
<p style="font-size: 18px; font-family: Arial; text-align: left; color: #5c5c5c; background-color: #ebeaec; padding: 10px;"> <b> <i>III. Answer any 3 questions from 17 β 20. Each carries 3 scores. (3 x 3 = 9)</i> </b> </p>
<div class="box">
<div class="question"> 17) Transport of electrons through ETS of the chloroplast results photophosphorylation. Write any three differences between cyclic and non-cyclic photo-phosphorylation. </div>
<div class="answer"> <p>β
<b>Answer</b></p> <b>Non-cyclic photo-phosphorylation:</b> <p> βͺοΈ It occurs when the two photosystems work in a series (PS II and PS I). <p> βͺοΈ ATP & NADPH + H+ are synthesised. <p> βͺοΈ It is a non-cyclic process because the electrons lost by PS II do not come back to it but pass on to NADP+. <p> <b>Cyclic photo-phosphorylation:</b> <p> βͺοΈ It occurs in stroma lamellae when only PS I is functional. <p> βͺοΈ The electron is circulated within the photosystem and the ATP synthesis occurs due to cyclic flow of electrons. <p> βͺοΈ Only ATP is synthesised. </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> 18) The following are the anatomical features of flowering plants. Arrange these features in the table given below: <p> i. Exarch xylem <p> ii. Presence of hypodermis <p> iii. Palisade parenchyma cells <p> iv. Conjoint and open vascular bundles <p> v. Endodermis with casparian strips <p> vi. Large empty bulliform cells <div class="separator" style="clear: both;"><a href="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEg60HWVjBsYLhK_bLBJ2fRRF_tknUutzCtfAmQKxyYRgbij6_kHbVcS2-1ZnHm3LvT3j4dQuRmNBhdt2or5yaOcablsdH74OQcuoJ_SLHxTfqSuc1TcE9QBOyNXenBj8GnIy1KKCUjimVNk-BITX4REL21_eGb48BIMNZC_cqnfVxP-bUIpaNQ00miosyQ/s1600/bob2.png" style="display: block; padding: 0; text-align: center; "><img alt="" border="0" data-original-height="93" data-original-width="350" src="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEg60HWVjBsYLhK_bLBJ2fRRF_tknUutzCtfAmQKxyYRgbij6_kHbVcS2-1ZnHm3LvT3j4dQuRmNBhdt2or5yaOcablsdH74OQcuoJ_SLHxTfqSuc1TcE9QBOyNXenBj8GnIy1KKCUjimVNk-BITX4REL21_eGb48BIMNZC_cqnfVxP-bUIpaNQ00miosyQ/s1600/bob2.png"/></a></div> </div>
<div class="answer"> <p>β
<b>Answer</b></p> <div class="separator" style="clear: both;"><a href="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEjzdrZKTWELTLHsWta681f8L-Uoe3qmpQi8jj09YXCDbqQfWCNzcmyYpd4IUVxxnSMiUtC-rRBobUgfAjVPrOCTOkzoy0_PezE8mJpIeVMH385WTjzQhalueKAbHDWJSCaVQl75J5wkMzka-U2UnU6wsNy3It1KOr_UH0axaIv43whR-2JJ4sa6P_Wf5gA/s1600/bob2.png" style="display: block; padding: 0; text-align: center; "><img alt="" border="0" data-original-height="186" data-original-width="400" src="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEjzdrZKTWELTLHsWta681f8L-Uoe3qmpQi8jj09YXCDbqQfWCNzcmyYpd4IUVxxnSMiUtC-rRBobUgfAjVPrOCTOkzoy0_PezE8mJpIeVMH385WTjzQhalueKAbHDWJSCaVQl75J5wkMzka-U2UnU6wsNy3It1KOr_UH0axaIv43whR-2JJ4sa6P_Wf5gA/s1600/bob2.png"/></a></div> </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> 19) Observe the given floral diagram. <div class="separator" style="clear: both;"><a href="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEi0t33dIuGs-TYpBzo_JyDJcshTooKVVQWlr6UZV-q70PkFnNYvyR5_wF-tgz6WxxgN4OuywyAeF0FAcJX6i6avXR6OtfeIHSkarLO81ionyAbv_xHODMteuqGH_kcHNHXY6rMy0VqctnY7ZqUB_rlVaGiFEhHX1hFsRv6pQ4y9xtVGUmbQJhls33R-qvo/s356/bob.jpg" style="display: block; padding: 0; text-align: center; "><img alt="" border="0" height="400" data-original-height="356" data-original-width="349" src="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEi0t33dIuGs-TYpBzo_JyDJcshTooKVVQWlr6UZV-q70PkFnNYvyR5_wF-tgz6WxxgN4OuywyAeF0FAcJX6i6avXR6OtfeIHSkarLO81ionyAbv_xHODMteuqGH_kcHNHXY6rMy0VqctnY7ZqUB_rlVaGiFEhHX1hFsRv6pQ4y9xtVGUmbQJhls33R-qvo/s400/bob.jpg"/></a></div> a. Identify the family. <p> b. Write down any two distinguishing features of gynoecium. <p> c. Write any two economically useful plants belonging to this family. </div>
<div class="answer"> <p>β
<b>Answer</b></p> (a) <i>Solanaceae</i> <p> (b) Gynoecium is bicarpellary obligately placed, syncarpous; ovary superior <p> (c) Tomato, brinjal, potato. </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> 20) An improved model of the structure of plasma membrane was proposed by Singer and Nicholson. <p> a. What is this model called? <p> b. Which component forms bilayer? <p> c. Briefly explain two types of proteins present in cell membrane. </div>
<div class="answer"> <p>β
<b>Answer</b></p> (a) Fluid mosaic model <p> (b) Lipids/Phosphoglycerides <p> (c) <b>Integral proteins:</b> Partially or totally buried in membrane. <p> <b>Peripheral proteins:</b> Lie on the surface of membrane. </div>
<button class="answer-button">View Answer</button>
</div>
<p style="font-size: 30px; font-family: Arial; text-align: center; color: #993d77; background-color: #ffe0f4; padding: 10px;"> <b> PART B: ZOOLOGY </b></p>
<p style="font-size: 18px; font-family: Arial; text-align: left; color: #5c5c5c; background-color: #ebeaec; padding: 10px;"> <b> <i>I. Answer any 3 questions from 1 β 5. Each carries 1 score. (3 x 1 = 3)</i> </b> </p>
<div class="box">
<div class="question">1) Unlike bony fishes, cartilage fishes are swim constantly to avoid sinking due to the <p> a. Presence of pharyngeal gill slits <p> b. Presence of air bladder <p> c. Absence of pharyngeal gill slits <p> d. Absence of air bladder </div>
<div class="answer"><p>β
d. Absence of air bladder. </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question">2) Volume of air that will remain in the lungs after a normal expiration is called β¦β¦β¦β¦β¦β¦. </div>
<div class="answer"><p>β
Functional Residual Capacity (FRC) </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question">3) Expand ICBN. </div>
<div class="answer"><p>β
International Code of Botanical Nomenclature. </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> 4) Structure of Malpighian body (renal corpuscle) is shown below. Label A and B. <div class="separator" style="clear: both;"><a href="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEieVWBSESWrS0rurVvL4xEjRbUaZbf1UfxObd_nXhscCutstN7Pq8xWjNNnQNZ9sPXQEB0lvqPdpCQ6JadslK0Yt4KDq_z_Z1G4TDYAKHCcRSghlwEeU_5VxlNHyxyGKcSd5perSUB43DWkJvyDkwnrV9zb5y0ISPXVWD8gMWHX000T4D6oPNWEs0STyVc/s400/bob.jpg" style="display: block; padding: 0; text-align: center; "><img alt="" border="0" width="400" data-original-height="398" data-original-width="400" src="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEieVWBSESWrS0rurVvL4xEjRbUaZbf1UfxObd_nXhscCutstN7Pq8xWjNNnQNZ9sPXQEB0lvqPdpCQ6JadslK0Yt4KDq_z_Z1G4TDYAKHCcRSghlwEeU_5VxlNHyxyGKcSd5perSUB43DWkJvyDkwnrV9zb5y0ISPXVWD8gMWHX000T4D6oPNWEs0STyVc/s400/bob.jpg"/></a></div> </div>
<div class="answer"> <p>β
A= Afferent arteriole B= Efferent arteriole </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question">5) Which of the part of brain control respiration and gastric secretions? <p> a. Cerebrum b. Medulla <p> c. Cerebellum d. Hypothalamus </div>
<div class="answer"><p>β
b. Medulla </div>
<button class="answer-button">View Answer</button>
</div>
<p style="font-size: 18px; font-family: Arial; text-align: left; color: #5c5c5c; background-color: #ebeaec; padding: 10px;"> <b> <i>II. Answer any 9 questions from 6 β 16. Each carries 2 scores. (9 x 2 = 18)</i> </b> </p>
<div class="box">
<div class="question"> 6) Major steps involved in muscle contraction are given below, which are not in the correct order. Arrange them in the correct order. <p> <center> a. Remove the mask of active sites for binding myosin <br> β <br> b. A signal sent out by CNS <br> β <br> c. Binding of Ca<sup>2+</sup> with troponin <br> β <br> d. Release of a neuro-transmitter substance <br> β <br> e. Release of Ca<sup>2+</sup> into the sarcoplasm </center> </div>
<div class="answer"> <p>β
<b>Answer</b></p> <center> a. A signal sent out by CNS <br> β <br> b. Release of a neuro-transmitter substance <br> β <br> c. Release of Ca<sup>2+</sup> into the sarcoplasm <br> β <br> d. Binding of Ca<sup>2+</sup> with troponin <br> β <br> e. Remove the mask of active sites for binding myosin </center> </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> 7) (a) Name the largest phylum of Animal kingdom. <p> (b) Mention any three distinguishing features of this phylum. </div>
<div class="answer"> <p>β
<b>Answer</b></p> (a) Arthropoda <p> (b) Chitinous exoskeleton. Body consists of head, thorax and abdomen. They have jointed appendages. </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> 8) List the major factors affecting the dissociation of oxygen from oxyhaemoglobin in the tissues. </div>
<div class="answer"> <p>β
<b>Answer</b></p> Low PO2, high PCO2, high H<sup>+</sup>, high temperature. </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> 9) Given below are some structures present in frog. Odd one out. Justify your answer. <p> <center> Common bile duct, conus arteriosus, oesophagus, microvilli </center> </div>
<div class="answer"> <p>β
<b>Answer</b></p> Conus arteriosus. Because it is a part of frogβs circulatory system. Others belong to digestive system. </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> 10) State whether the following statements are true/false. If false, correct it. <p> a. ADH prevents diuresis. <p> b. ANF causes the increase of blood pressure. <p> c. Angiotensin-l activate adrenal cortex to release aldosterone. <p> d. Aldosterone causes the reabsorption of Na+ and water from the distal part of renal tubule. </div>
<div class="answer"> <p>β
<b>Answer</b></p> (a) True <p> (b) False. ANF decreases blood pressure. <p> (c) False. Angiotensin-II activates adrenal cortex to release aldosterone. <p> (d) True. </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> 11) Name of the bones of appendicular skeleton are given below: <p> <center> Clavicle, Humerus, Tibia, Patella </center> <p> a. Select the bones of pectoral girdle. <p> b. Name the articulating cavity between femur and pelvic girdle. </div>
<div class="answer"> <p>β
<b>Answer</b></p> (a) Clavicle, Scapula. <p> (b) Acetabulum. </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> 12) The following are organs of certain animals: <p> <center> Parapodia, Flame cells, Proboscis gland, Comb plates </center> <p> a. Select organs helps in excretion. <p> b. Name the organism bearing these organs and its phylum. </div>
<div class="answer"> <p>β
<b>Answer</b></p> (a) Flame cells, Proboscis gland <p> (b) Flame cells: Phylum Platyhelminthes. E.g. Liver fluke <p> Proboscis gland: Phylum Hemichordata. E.g. <i>Balanoglossus</i>. </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> 13) General structure of amino acid is given. Draw the structure of the amino acids, (a) glycine and (b) Serine. <div class="separator" style="clear: both;"><a href="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEiCqoGwO0kFGaEw4DgzU6c_I7zYleVEaBfUqOaRvldwB9s6XKco5QuD27vsggxcIpq5tFrvtBK1e0RiNL0EwJOTTmBJTp3NScMGhWpkQ5t6w4u4TmiSfyRLufkyCf801BZT4c7zoCdJctsmhdwU-NugE1Oi4vggMKkf5toKx965a16FCnUBUlWu3vjmL-4/s1600/bob.jpg" style="display: block; padding: 0; text-align: center; "><img alt="" border="0" data-original-height="105" data-original-width="126" src="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEiCqoGwO0kFGaEw4DgzU6c_I7zYleVEaBfUqOaRvldwB9s6XKco5QuD27vsggxcIpq5tFrvtBK1e0RiNL0EwJOTTmBJTp3NScMGhWpkQ5t6w4u4TmiSfyRLufkyCf801BZT4c7zoCdJctsmhdwU-NugE1Oi4vggMKkf5toKx965a16FCnUBUlWu3vjmL-4/s1600/bob.jpg"/></a></div> </div>
<div class="answer"> <p>β
<b>Answer</b></p> <div class="separator" style="clear: both;"><a href="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEgH0d4o9lBpcsLJ3Xk4O1OedUlco4cdU-X3m6EpfZjmEmB6ABWA4yZ27LPSAf8SSH3UywDEEqO31M7L-ZHGf4xmTHu6UwI71YE9z_Mm3HVSQOenEk5zixUHJTYCC37vwspU9eI3icX6ASYncuZkU4EDIlSXNLx6m4BUml5w95gIznWcXuQUcys9Kr-aQm0/s1600/bob2.png" style="display: block; padding: 1em 0; text-align: center; "><img alt="" border="0" data-original-height="157" data-original-width="325" src="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEgH0d4o9lBpcsLJ3Xk4O1OedUlco4cdU-X3m6EpfZjmEmB6ABWA4yZ27LPSAf8SSH3UywDEEqO31M7L-ZHGf4xmTHu6UwI71YE9z_Mm3HVSQOenEk5zixUHJTYCC37vwspU9eI3icX6ASYncuZkU4EDIlSXNLx6m4BUml5w95gIznWcXuQUcys9Kr-aQm0/s1600/bob2.png"/></a></div> </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> 14) Distinguish between the following: <p> a. Electrical synapse and Chemical synapse <p> b. Bipolar and multipolar neurons. </div>
<div class="answer"> <p>β
<b>Answer</b></p> <b>(a) Electrical synapse:</b> The membranes of pre- and post-synaptic neurons are nearer. Faster impulse transmission. <p> <b>Chemical synapse:</b> There is a fluid filled space (synaptic cleft) between the presynaptic neuron and postsynaptic neuron. <p> (b) <b>Bipolar neurons</b> have one axon and one dendrite. <p> <b>Multipolar neurons</b> have one axon and two or more dendrites. </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> 15) Identify the picture and label the parts A, B, C, D. <div class="separator" style="clear: both;"><a href="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEjVKlPRP0_MhSQ0QOBubGGOoBdSalJnO0BH6jbWjDaP3o_Z7FxfoJjI-h2igIPZnjOitwPKHHg-TJcFMWDMUkvUxRnlIDypEpAo-Zpav0qb0j3qIKiI7kxkbCxgMNKj3p31mPLbpAlzJJknAoI1mMLn_HsPdzKUEesuorLexBg1KWPTCmydPTO6mpcwqxU/s1600/bob.jpg" style="display: block; padding: 0; text-align: center; "><img alt="" border="0" data-original-height="313" data-original-width="331" src="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEjVKlPRP0_MhSQ0QOBubGGOoBdSalJnO0BH6jbWjDaP3o_Z7FxfoJjI-h2igIPZnjOitwPKHHg-TJcFMWDMUkvUxRnlIDypEpAo-Zpav0qb0j3qIKiI7kxkbCxgMNKj3p31mPLbpAlzJJknAoI1mMLn_HsPdzKUEesuorLexBg1KWPTCmydPTO6mpcwqxU/s1600/bob.jpg"/></a></div> </div>
<div class="answer"> <p>β
<b>Answer</b></p> Hypothalamus and pituitary. <p> A= Hypothalamus <p> B= Posterior pituitary <p> C= Anterior pituitary <p> D= Portal circulation </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> 16) (a) Make a flowchart showing cardiac impulse conduction using appropriate terms given in bracket. <p> <center> [SAN, Right atrium, AVN, AV Bundle, Bundle of His, Ventricle] </center> <p> (b) Which part known as pacemaker? </div>
<div class="answer"> <p>β
<b>Answer</b></p> (a) SAN β Right atrium β AVN β AV Bundle β Bundle of His β Ventricle. <p> (b) SA node (SAN) </div>
<button class="answer-button">View Answer</button>
</div>
<p style="font-size: 18px; font-family: Arial; text-align: left; color: #5c5c5c; background-color: #ebeaec; padding: 10px;"> <b> <i>III. Answer any 3 questions from 17 β 20. Each carries 3 scores. (3 x 3 = 9)</i> </b> </p>
<div class="box">
<div class="question"> 17) Complete the Schematic diagram. <div class="separator" style="clear: both;"><a href="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEgrT8NaWradkP1KuH7sj64mcC75X1xGqH6P1OgZknGBtMANNn3XXtiAJdu36XXOoJQ6r18mAcGmdAWeW1R77Vj899ReB0zZriuJeNYEa8-U1r-d5GMl52QsxiO0fGxGTejwiCjdgv3CtlPCP91OwB6WVGCVfjcKoOKOhxji50QR9ih8lxzXpJ9wzB7ctNA/s1600/bob.jpg" style="display: block; padding: 0; text-align: center; "><img alt="" border="0" data-original-height="515" data-original-width="701" src="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEgrT8NaWradkP1KuH7sj64mcC75X1xGqH6P1OgZknGBtMANNn3XXtiAJdu36XXOoJQ6r18mAcGmdAWeW1R77Vj899ReB0zZriuJeNYEa8-U1r-d5GMl52QsxiO0fGxGTejwiCjdgv3CtlPCP91OwB6WVGCVfjcKoOKOhxji50QR9ih8lxzXpJ9wzB7ctNA/s1600/bob.jpg"/></a></div> </div>
<div class="answer"> <p>β
<b>Answer</b></p> A= Tissue/organ/organ system <p> B= Bilateral <p> C= Pseudocoelom <p> D= Ctenophora <p> E= Mollusca <p> F= Hemichordata </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> 18) Following are the hormones produced by tissues other than endocrine glands. Write the part where it is produced and mention the function of each. <p> a. Cholecystokinin b. Gastrin c. Secretin </div>
<div class="answer"> <p>β
<b>Answer</b></p> <b>(a) Cholecystokinin:</b> From gastro-intestinal tract. Function: Stimulates secretion of pancreatic juice. <p> <b>(b) Gastrin:</b> From gastro-intestinal tract. Function: Stimulates secretion of HCl in gastric glands. <p> <b>(c) Secretin:</b> From gastro-intestinal tract. Function: Stimulates secretion of water and bicarbonate ions. </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> 19) Match the following: <div class="separator" style="clear: both;"><a href="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEj-iyUWU5u0wNxsFkTg2oGipvE4gln1_JNtdUuzyYqqKvF7ar6R5nPW2Qj0DdfNiiu4Qkz1wmsOjvI3yum9qVntqz7yvXek_2q9qCM9e4SUxLp3JsXv4xbS2cC5Mz7vouhkV8N0QPnfE5SzZyB3ySG4xmB0QLPTslbM-NYb2E4mqjWv0Dp3JpN9-hUMNcA/s1600/bob2.png" style="display: block; padding: 0; text-align: center; "><img alt="" border="0" data-original-height="160" data-original-width="400" src="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEj-iyUWU5u0wNxsFkTg2oGipvE4gln1_JNtdUuzyYqqKvF7ar6R5nPW2Qj0DdfNiiu4Qkz1wmsOjvI3yum9qVntqz7yvXek_2q9qCM9e4SUxLp3JsXv4xbS2cC5Mz7vouhkV8N0QPnfE5SzZyB3ySG4xmB0QLPTslbM-NYb2E4mqjWv0Dp3JpN9-hUMNcA/s1600/bob2.png"/></a></div> </div>
<div class="answer"> <p>β
<b>Answer</b></p> <div class="separator" style="clear: both;"><a href="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEhE5ICBbQITd1KzGPM9ck0OmRn-3bDHEi3YGp1PEmuvmlxcp0WPITL2Uu9AxHHRAPSxZBaLVIGgMfERi6fIjo2Nj3zC6JOAYK2jU2E8_mwBpqlWMfQ4i25bdANVQdp5-mB3fMS19WLNF8hSSQvChFaBRmfeuXbRPF8tq2y_Tw59f73Hg4FEgq6PFaSyU1w/s1600/bob2.png" style="display: block; padding: 0; text-align: center; "><img alt="" border="0" data-original-height="265" data-original-width="400" src="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEhE5ICBbQITd1KzGPM9ck0OmRn-3bDHEi3YGp1PEmuvmlxcp0WPITL2Uu9AxHHRAPSxZBaLVIGgMfERi6fIjo2Nj3zC6JOAYK2jU2E8_mwBpqlWMfQ4i25bdANVQdp5-mB3fMS19WLNF8hSSQvChFaBRmfeuXbRPF8tq2y_Tw59f73Hg4FEgq6PFaSyU1w/s1600/bob2.png"/></a></div> </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> 20) Blood coagulation is a mechanism to prevent the excessive loss of blood. Draw a flowchart showing the various events in blood coagulation. </div>
<div class="answer"> <p>β
<b>Answer</b></p> Clumped platelets & tissues release thromboplastin β It forms <i>thrombokinase</i> (<i>Prothrombinase</i>) enzyme β <i>Thrombokinase</i> hydrolyses prothrombin to thrombin enzyme in presence of Ca<sup>2+</sup> β Thrombin converts soluble fibrinogen to insoluble fibrin β Fibrin threads trap dead & damaged blood cells to form clot (coagulum). </div>
<button class="answer-button">View Answer</button>
</div>
<script>
// Get all the answer buttons
const answerButtons = document.querySelectorAll('.answer-button');
// Add a click event listener to each answer button
answerButtons.forEach(button => {
button.addEventListener('click', () => {
// Get the answer section for this button
const answerSection = button.previousElementSibling;
// Toggle the answer section's visibility
answerSection.classList.toggle('visible');
// Change the button text to "Hide Answer" or "View Answer"
if (answerSection.classList.contains('visible')) {
button.textContent = 'Hide Answer';
button.classList.add('hide-answer');
} else {
button.textContent = 'View Answer';
button.classList.remove('hide-answer');
}
});
});
</script>
<html>
<head>
<style>
.special-paragraph {
margin-bottom: -10px; /* Adjust this value to reduce the space */
color: #333333;
font-family: Arial, sans-serif;
font-size: 23px;
font-weight: bold;
line-height: 1.5;
padding: 7px;
text-align: center;
border-radius: 10px;
}
.green-bg {
background-color: #ddffd9; /* Green background */
}
.blue-bg {
background-color: #b0eaff; /* Blue background */
}
</style>
</head>
<body>
<p class="special-paragraph green-bg">
<a href="https://www.bankofbiology.com/2020/10/hse-1-2-model-qp-online-exam-series.html" style="color: green;"> π Other Question Papers </a>
</p>
<p class="special-paragraph blue-bg">
<a href="https://www.bankofbiology.com/p/question-bank.html" style="color: blue;"> π Exam Special Materials </a>
</p>
</body>
</html>
<div class="blogger-post-footer"><p> Β© copyright 2024 β All rights reserved </p>
<a href=βhttps://www.bankofbiology.comβ>bankofbiology.com</a></div>Abu Raniyahttp://www.blogger.com/profile/14189496606355139812noreply@blogger.com0tag:blogger.com,1999:blog-6823671394482492613.post-25306734010982406832024-03-18T07:58:00.049+05:302024-03-18T12:49:52.143+05:30Plus One Biology (Bot + Zoo) | Practice Model Question Paper PDF with Answer key | SET 1<!DOCTYPE html>
<html>
<head>
<title>Example Webpage</title>
<style>
body {
user-select: none; /* Prevent selection of text */
-moz-user-select: none; /* Firefox */
-webkit-user-select: none; /* Safari and Chrome */
-ms-user-select: none; /* Internet Explorer/Edge */
}
h1 {
user-select: text; /* Allow selection of title */
}
</style>
</head>
<p style="font-size: 25px; font-family: Arial; text-align: center; color: #2068d4; line-height: 1.5;"> <b> π <a href="https://drive.google.com/file/d/1FS9gwUaD5WZiZHZ0pJ8YZJw1YTzh0kyz/view?usp=drive_link" target="_blank">Download Biology Question Paper PDF - SET 1</a> </b> </p>
<style>
/* Customize the box style */
.box {
background-color: #ffffff;
border: 1px solid #ffffff;
border-radius: 1px;
padding: 10px;
margin-bottom: 10px;
margin-right: -14px;
margin-left: -14px;
}
/* Customize the question style */
.question {
font-size: 17px;
font-weight: bold;
color: #3D4849;
font-family: Open Sans;
margin-bottom: 10px;
}
/* Customize the answer style */
.answer {
font-size: 18px;
font-weight: normal;
font-family: Roboto;
margin-bottom: 10px;
background-color: #e7ffde;
}
/* Hide the answer by default */
.answer {
display: none;
}
/* Customize the view/hide answer button */
.answer-button {
background-color: #4CAF50;
border: none;
border-radius: 5px;
color: white;
padding: 8px 16px;
text-align: center;
text-decoration: none;
display: inline-block;
font-size: 18px;
margin-bottom: 1px;
cursor: pointer;
}
/* Style the button differently when it changes to "Hide Answer" */
.answer-button.hide-answer {
background-color: #f44336;
}
/* Show the answer when the visible class is added */
.answer.visible {
display: block;
}
.table-text {
display: grid;
grid-template-columns: 50% 50%;
grid-gap: none;
margin-top: 5px;
border-collapse: collapse;
}
.table-text-2 {
display: grid;
grid-template-columns: 33.33% 33.33% 33.33%;
grid-gap: none;
margin-top: 5px;
border-collapse: collapse;
}
.table-text-header,
.table-text-cell {
padding: 5px;
border: 1px solid black;
text-align: left;
}
.table-text-header {
font-weight: bold;
text-align: center;
}
.no-break {
white-space: nowrap;
}
.tab {
text-indent: 40px; /* Adjust the value as per your preference */
}
blockquote {
background: none; /* Remove background color */
border: none; /* Remove border */
margin: 0; /* Remove default margin */
padding: 0 0 0 20px; /* Retain padding on the left side */
quotes: none; /* Remove quote marks */
}
blockquote:before {
content: none; /* Remove quote marks */
}
</style>
<p style="font-size: 30px; font-family: Arial; text-align: center; color: #0c8a7d; background-color: #a2f5d3; padding: 10px;"> <b> PART A: BOTANY </b></p>
<p style="font-size: 18px; font-family: Arial; text-align: left; color: #5c5c5c; background-color: #ebeaec; padding: 10px;"> <b> <i>I. Answer any 3 questions from 1 β 5. Each carries 1 score. (3 x 1 = 3)</i> </b> </p>
<div class="box">
<div class="question">1) The organelle known as power house of the cell is <p> a. Ribosome b. Vacuole <p> c. Mitochondrion d. Chloroplast </div>
<div class="answer"><p>β
(c) Mitochondrion </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question">2) Casparian strips are present in <p> a. Dicot root b. Dicot stem <p> c. Dicot leaf d. Monocot stem </div>
<div class="answer"><p>β
(a) Dicot root </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question">3) In lichen, the algal component is known as β¦β¦β¦(a) β¦β¦β¦. and fungal component as β¦β¦β¦(b) β¦β¦β¦. </div>
<div class="answer"><p>β
(a) phycobiont (b) mycobiont </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> 4) Observe the relationship between the first two terms and fill in the blank. <p> Metaphase: Spindle fibres attach to kinetochores. <p> ......................: Chromatids move to opposite poles. </div>
<div class="answer"> <p>β
Anaphase </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question">5) Fill in the blank. The number of carbon atoms in acetyl co-enzyme A, which take part in Krebsβ cycle is .............. </div>
<div class="answer"><p>β
2 </div>
<button class="answer-button">View Answer</button>
</div>
<p style="font-size: 18px; font-family: Arial; text-align: left; color: #5c5c5c; background-color: #ebeaec; padding: 10px;"> <b> <i>II. Answer any 9 questions from 6 β 16. Each carries 2 scores. (9 x 2 = 18)</i> </b> </p>
<div class="box">
<div class="question"> 6) R.H. Whittaker proposed Five-Kingdom classification based on certain criteria. Mention any four of them. </div>
<div class="answer"> <p>β
<b>Answer</b></p> <blockquote> β’ Cell structure - Prokaryotes or Eukaryotes <p> β’ Thallus organisation - Unicellular or Multicellular <p> β’ Mode of nutrition - Autotrophic or Heterotrophic <p> β’ Phylogenetic relationships</blockquote>
</div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> 7) Analyse the table given below and fill in the blanks. <div class="separator" style="clear: both;"><a href="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEgSahjEanO_iIkltAHJpeHvQuMvreC8ffRwubOWg2igGs9N6qMPXWwybn1PmlTaReZO8QNVAQ31PekYBAIpIz1ndgyUQIRLxElkrO8ZTMmzCQhhyphenhyphenTXcwT47g0kHPyO1kH3WB1spHGEnDWPpxLW7-KLZswr7t3ad415gJR_fM9MAm-9BiFSF-5qqhAf_ilw/s693/bob.jpg" style="display: block; padding: 0; text-align: center; "><img alt="" border="0" width="600" data-original-height="177" data-original-width="693" src="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEgSahjEanO_iIkltAHJpeHvQuMvreC8ffRwubOWg2igGs9N6qMPXWwybn1PmlTaReZO8QNVAQ31PekYBAIpIz1ndgyUQIRLxElkrO8ZTMmzCQhhyphenhyphenTXcwT47g0kHPyO1kH3WB1spHGEnDWPpxLW7-KLZswr7t3ad415gJR_fM9MAm-9BiFSF-5qqhAf_ilw/s600/bob.jpg"/></a></div> </div>
<div class="answer"> <p>β
<b>Answer</b></p> (a) Synapsis <p> (b) Pachytene <p> (c) Diplotene <p> (d) Terminalization of chiasmata. </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> 8) Algae are economically very important for human. Justify this statement giving any four examples. </div>
<div class="answer"> <p>β
<b>Answer</b></p> a) Agar obtained from <i>Gelidium</i> and <i>Gracillaria</i> are used as tissue culture medium. <p> b) Spirulina are used as food supplement for space travelers.<p> c) Laminaria and Sargassum are used as food. <p> d) Algin (brown algae) and carrageen (red algae) produce hydrocolloids (water holding substances). </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> 9) Peculiarities of certain cell organelles are given below: <p> a. Involved in protein synthesis. <p> b. Made up of many flat, disc shaped sacs or cisternae. <p> c. Bear ribosomes on their surface. <p> d. Rich in hydrolytic enzymes. <p> e. Membrane is absent. <p> Copy the table given below and write the above peculiarities in appropriate column. <div class="separator" style="clear: both;"><a href="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEi0uUHghL6npX_jfS_02ZYzdg4RJ7CkDRRUI_FMBdf25a_8HOjK3-viUc9fG1gfVyyflhn2LsEc92C2Q9UqkdNKy8B2J2VEC-4TIor-dVfnypjXIS3S_9ei_4-b6ojbbnc1vcTBRj9O1P9JiZhwRhamOCHFpkH3VJxm7NgnTStZw0M7x5LzlwHLfP4AZHA/s475/bob.jpg" style="display: block; padding: 0; text-align: center; "><img alt="" border="0" width="600" data-original-height="118" data-original-width="475" src="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEi0uUHghL6npX_jfS_02ZYzdg4RJ7CkDRRUI_FMBdf25a_8HOjK3-viUc9fG1gfVyyflhn2LsEc92C2Q9UqkdNKy8B2J2VEC-4TIor-dVfnypjXIS3S_9ei_4-b6ojbbnc1vcTBRj9O1P9JiZhwRhamOCHFpkH3VJxm7NgnTStZw0M7x5LzlwHLfP4AZHA/s600/bob.jpg"/></a></div> </div>
<div class="answer"> <p>β
<b>Answer</b></p> <div class="separator" style="clear: both;"><a href="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEizhdWRn_d0Y1_E-Ak3YtNsHWwcpR1Wmi0tVPe-oRI9tP9xfm75BTMKolIkmcFLWR5NnF6CK_FoAm0ivHeZxMO5vguMYoUy8Ig0L6gKIUwJNXGbCAtw25rqFQ0jX1EQIY5aHzH75BsaJXNkde5bgZ-Xe2sfSO5Nn2GAw7eDpum1iro3RaA5lwNKWB9lhWU/s1600/bob2.png" style="display: block; padding: 0; text-align: center; "><img alt="" border="0" data-original-height="200" data-original-width="450" src="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEizhdWRn_d0Y1_E-Ak3YtNsHWwcpR1Wmi0tVPe-oRI9tP9xfm75BTMKolIkmcFLWR5NnF6CK_FoAm0ivHeZxMO5vguMYoUy8Ig0L6gKIUwJNXGbCAtw25rqFQ0jX1EQIY5aHzH75BsaJXNkde5bgZ-Xe2sfSO5Nn2GAw7eDpum1iro3RaA5lwNKWB9lhWU/s1600/bob2.png"/></a></div> </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> 10) Analyse the table given below and fill in the blanks a, b, c, d. <div class="separator" style="clear: both;"><a href="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEi-dej8V4-vyDgBA0JHeytDHplTPgIgLsuqymXUPUt-QzS7gmtYzjNArApwwKmMJb6Dw7c3XfvhEj8FXaFvF1LEozU0I3ScriTAr-xx1qQvTT8m-tzsBYVTBh_Zaosui7awvJ3pcs1Rs51VZeMs2YKgJoKj0PblYW3scD-myKYuphd8-rnctwdYASIRVrg/s739/bob.jpg" style="display: block; padding: 0; text-align: center; "><img alt="" border="0" width="600" data-original-height="187" data-original-width="739" src="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEi-dej8V4-vyDgBA0JHeytDHplTPgIgLsuqymXUPUt-QzS7gmtYzjNArApwwKmMJb6Dw7c3XfvhEj8FXaFvF1LEozU0I3ScriTAr-xx1qQvTT8m-tzsBYVTBh_Zaosui7awvJ3pcs1Rs51VZeMs2YKgJoKj0PblYW3scD-myKYuphd8-rnctwdYASIRVrg/s600/bob.jpg"/></a></div> </div>
<div class="answer"> <p>β
<b>Answer</b></p> (a) Non-cyclic <p> (b) 1 <p> (c) 2 <p> (d) Absent </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> 11) The first step in respiration is glycolysis. <p> a. Define glycolysis. <p> b. Write the site of glycolysis. </div>
<div class="answer"> <p>β
<b>Answer</b></p> (a) Glycolysis is the breakdown of glucose in to pyruvic acid. <p> (b) Cytoplasm. </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> 12) Aerobic respiration and anaerobic respiration are two types of respiration. <p> a. What is anaerobic respiration? <p> b. Write the change that occurs to pyruvic acid in yeast cells. </div>
<div class="answer"> <p>β
<b>Answer</b></p> (a) Anaerobic respiration is the incomplete oxidation of glucose in the absence of oxygen. <p> (b) Pyruvic acid is converted to ethanol and CO2. </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> 13) Notice the three stages of Calvin cycle given below: <p> Reduction, Regeneration, Carboxylation <p> a. Arrange the above stages in correct order. <p> b. Calvin cycle is also known as C3 cycle (Pathway). Give reason. </div>
<div class="answer"> <p>β
<b>Answer</b></p> (a) Carboxylation, Reduction, Regeneration. <p> (b) First stable product is a C3 compound (3-PGA). </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> 14) Match the items of column A with B. <div class="separator" style="clear: both;"><a href="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEhbaCJqebu-f1-wVnIVjABNymHZvFIzXcFAsJMSgqB6QSvvc3StfJLJntALyITZ8qPzyfvDPB0TF6YY1FbToSikrj7RaenSqJqSI9efWQ2hK5Ww4qBmYwwxEMIXXNc6E1oywgeKDe5ZUyI6sm8e9j50C87qW0EtenWxpFbo9zNeek0LSRaaRJrF-nnW1lc/s504/bob.jpg" style="display: block; padding: 1em 0; text-align: center; "><img alt="" border="0" width="600" data-original-height="213" data-original-width="504" src="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEhbaCJqebu-f1-wVnIVjABNymHZvFIzXcFAsJMSgqB6QSvvc3StfJLJntALyITZ8qPzyfvDPB0TF6YY1FbToSikrj7RaenSqJqSI9efWQ2hK5Ww4qBmYwwxEMIXXNc6E1oywgeKDe5ZUyI6sm8e9j50C87qW0EtenWxpFbo9zNeek0LSRaaRJrF-nnW1lc/s600/bob.jpg"/></a></div> </div>
<div class="answer"> <p>β
<b>Answer</b></p> <div class="separator" style="clear: both;"><a href="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEiwaexuaLevxq45NxNCDy7nRJ9Ujq0UTvxtIBNd2NJBbhA2vzFwa9iRjBQi_6F4AmRirrZQrKbRl_TlZX6HztXjxEQcbDktQRVYVBmLtuB_xz5nscefu0qnMzjjSEB15TrjAsYnn4l318PZMBMd-vZphEHg0kkBEmF5dfiAbU20XsLPdNxgYUcBnrJPX3c/s1600/bob2.png" style="display: block; padding: 0; text-align: center; "><img alt="" border="0" data-original-height="174" data-original-width="400" src="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEiwaexuaLevxq45NxNCDy7nRJ9Ujq0UTvxtIBNd2NJBbhA2vzFwa9iRjBQi_6F4AmRirrZQrKbRl_TlZX6HztXjxEQcbDktQRVYVBmLtuB_xz5nscefu0qnMzjjSEB15TrjAsYnn4l318PZMBMd-vZphEHg0kkBEmF5dfiAbU20XsLPdNxgYUcBnrJPX3c/s1600/bob2.png"/></a></div> </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> 15) (a) Name the two scientists who formulated Cell theory. <p> (b) Write the two main points in cell theory. </div>
<div class="answer"> <p>β
<b>Answer</b></p> (a) Schleiden and Schwann <p> (b) βͺοΈ All living organisms are composed of cells and product of cells. <p> βͺοΈ All cells arise from pre-existing cells. </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> 16) Observe the figures A and B given below: <div class="separator" style="clear: both;"><a href="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEhuAdArrRrdfPvD8sduoeeD7FmNgcaiHGiDkOBXKdyVmmpe2ATPYlY9Nx6xUkUox_QJzMhEHdiJup20_BcvC633890-n2BoF8sGPIuYjky4NCz7eoboBtyLEO1od9pqRsuMlIy1qd13EmGCcKJquJkrb6EpAu-MrDsgpEgUByqWY3yMMRdNHbLx3BcjVbs/s1600/bob.jpg" style="display: block; padding: 0; text-align: center; "><img alt="" border="0" data-original-height="290" data-original-width="246" src="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEhuAdArrRrdfPvD8sduoeeD7FmNgcaiHGiDkOBXKdyVmmpe2ATPYlY9Nx6xUkUox_QJzMhEHdiJup20_BcvC633890-n2BoF8sGPIuYjky4NCz7eoboBtyLEO1od9pqRsuMlIy1qd13EmGCcKJquJkrb6EpAu-MrDsgpEgUByqWY3yMMRdNHbLx3BcjVbs/s1600/bob.jpg"/></a></div> a. Name the type of venation in A and B. <p> b. Define venation. </div>
<div class="answer"> <p>β
<b>Answer</b></p> (a) A= Reticulate venation, <p> B= Parallel venation. <p> (b) It is the arrangement of veins and veinlets in the leaf lamina </div>
<button class="answer-button">View Answer</button>
</div>
<p style="font-size: 18px; font-family: Arial; text-align: left; color: #5c5c5c; background-color: #ebeaec; padding: 10px;"> <b> <i>III. Answer any 3 questions from 17 β 20. Each carries 3 scores. (3 x 3 = 9)</i> </b> </p>
<div class="box">
<div class="question"> 17) Observe the given figure showing C4 pathway. <div class="separator" style="clear: both;"><a href="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEiMoXLm6cYiCmSMColuGgn8adjuXf0XhKr7DOUBa9-lkTalKHBewC9d0xHtHUNbjxSwfkCO53zwrp654NX7-6HnRUB9QUod7MqpRDnpHaKb9TFNdJawCTVeljQf-SMY3_abgIhjprzqJqrEmNCRGWVsIiGxYcKl2xVTD6XO43CkeXB1hOP_tWzugwccpNw/s1600/bob.jpg" style="display: block; padding: 0; text-align: center; "><img alt="" border="0" data-original-height="546" data-original-width="438" src="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEiMoXLm6cYiCmSMColuGgn8adjuXf0XhKr7DOUBa9-lkTalKHBewC9d0xHtHUNbjxSwfkCO53zwrp654NX7-6HnRUB9QUod7MqpRDnpHaKb9TFNdJawCTVeljQf-SMY3_abgIhjprzqJqrEmNCRGWVsIiGxYcKl2xVTD6XO43CkeXB1hOP_tWzugwccpNw/s1600/bob.jpg"/></a></div> a. Identify the cells A and B. <p> b. Name the C4 acid formed through this pathway. <p> c. Name the enzyme involved in the formation of C4 acid. </div>
<div class="answer"> <p>β
<b>Answer</b></p> (a) A= Mesophyll Cell, <p> B= Bundle sheath cell <p> (b) OAA/ Malic acid / Aspartic acid <p> (c) PEP carboxylase (PEP case) </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> 18) Observe the figures A and B. <div class="separator" style="clear: both;"><a href="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEjHLC5bLzTQ_F6bGOje1vVzM2zqX3sQDdOlXUd9ny3wTbwqiAs3KNAZRKK1MjBdvp_5aeUvuxm4HJcoFNj1WyBq_XKPiNmiU2c1Jq3_iIxLp-tTVB_7OGNSmk98vBusqDD5jgY_4AKrqXz93vAmeIeLnZZyBu9eUlbCnvu2q1OG0uLW6RP49k9kIzMNijQ/s1600/bob.jpg" style="display: block; padding: 0; text-align: center; "><img alt="" border="0" data-original-height="197" data-original-width="394" src="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEjHLC5bLzTQ_F6bGOje1vVzM2zqX3sQDdOlXUd9ny3wTbwqiAs3KNAZRKK1MjBdvp_5aeUvuxm4HJcoFNj1WyBq_XKPiNmiU2c1Jq3_iIxLp-tTVB_7OGNSmk98vBusqDD5jgY_4AKrqXz93vAmeIeLnZZyBu9eUlbCnvu2q1OG0uLW6RP49k9kIzMNijQ/s1600/bob.jpg"/></a></div> a. Identify the aestivation A and B. <p> b. Write one peculiarity of A. <p> c. Name the three kinds of petals in B. </div>
<div class="answer"> <p>β
<b>Answer</b></p> (a) A= Twisted, B. Vexillary/ Papilionaceous <p> (b) One margin of each member overlap that of the next one. <p> (c) Standard petal, wing petals, keel petal (anterior small petal). </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> 19) The plant growth regulators are divided into growth promoters and growth inhibitors. <p> a. Name the three hormones, which are known as plant growth promoters. <p> b. Name the growth inhibitor which is known as ' stress hormone'. <p> c. Write any two roles of the above identified stress hormone. </div>
<div class="answer"> <p>β
<b>Answer</b></p> (a) Auxin, Cytokinin, Gibberellin. <p> (b) Abscisic acid (ABA) <p> (c) βͺοΈ Inhibit seed germination. <p> βͺοΈ Helps to withstand desiccation. </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> 20) Observe the figure given below. Write any three features on mesophyll cells from the figure. <div class="separator" style="clear: both;"><a href="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEiVflsHbjS1xyLjcKOuC7nOJa0P1hdaV7bCQWNcdz2wamlul0LylNPryHJr-De9GfYIVqTFuK5di2qkUvLDhh8bHALNRlyJsNMT-aDWS0ZzO_qNegRNj6UbvD7xt5zF66Z5ZmSZKTQ5F-egeQ_nRlV2pEXydfgZORrLvjvbW2S3XZUWXSfHK0nMcxO_TL4/s1600/bob.jpg" style="display: block; padding: 0; text-align: center; "><img alt="" border="0" data-original-height="329" data-original-width="446" src="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEiVflsHbjS1xyLjcKOuC7nOJa0P1hdaV7bCQWNcdz2wamlul0LylNPryHJr-De9GfYIVqTFuK5di2qkUvLDhh8bHALNRlyJsNMT-aDWS0ZzO_qNegRNj6UbvD7xt5zF66Z5ZmSZKTQ5F-egeQ_nRlV2pEXydfgZORrLvjvbW2S3XZUWXSfHK0nMcxO_TL4/s1600/bob.jpg"/></a></div> </div>
<div class="answer"> <p>β
<b>Answer</b></p> βͺοΈ Present between upper and lower epidermis. <p> βͺοΈ Made up of parenchyma cells. <p> βͺοΈ Divided in to palisade and spongy parenchyma. </div>
<button class="answer-button">View Answer</button>
</div>
<p style="font-size: 30px; font-family: Arial; text-align: center; color: #993d77; background-color: #ffe0f4; padding: 10px;"> <b> PART B: ZOOLOGY </b></p>
<p style="font-size: 18px; font-family: Arial; text-align: left; color: #5c5c5c; background-color: #ebeaec; padding: 10px;"> <b> <i>I. Answer any 3 questions from 1 β 5. Each carries 1 score. (3 x 1 = 3)</i> </b> </p>
<div class="box">
<div class="question">1) Select the enzyme that facilitate the following reaction: <div class="separator" style="clear: both;"><a href="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEgV0uIZiD1HWwDvlfgVKzUHmrGocCS5DxHeqM7Qd_0owUOK2eoesD3ttAxvTG01nYLbQ77qwaRYRucIpdGsEP6WSp0t3oIoyFWSo0w68MNATDhxGE4nGJ-QIeKyEmqH4JxpeMCf8Es2A4Ro5NZhDytRj_XiW_4a4xkxIdDB7ToTNMbmiMCtX3HwmhCWBzA/s1600/bob.jpg" style="display: block; padding: 0; text-align: center; "><img alt="" border="0" data-original-height="63" data-original-width="647" src="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEgV0uIZiD1HWwDvlfgVKzUHmrGocCS5DxHeqM7Qd_0owUOK2eoesD3ttAxvTG01nYLbQ77qwaRYRucIpdGsEP6WSp0t3oIoyFWSo0w68MNATDhxGE4nGJ-QIeKyEmqH4JxpeMCf8Es2A4Ro5NZhDytRj_XiW_4a4xkxIdDB7ToTNMbmiMCtX3HwmhCWBzA/s1600/bob.jpg"/></a></div> <p> a. <i>Succinic dehydrogenase</i> b. <i>RuBiSCO</i> <p> c. <i>Carbonic anhydrase</i> d. <i>Lipase</i> </div>
<div class="answer"><p>β
(c) <i>Carbonic anhydrase</i> </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question">2) Which among the following is a primary metabolite? <p> <center> Alkaloids, Antibiotics, Amino acids, Flavonoids </center></div>
<div class="answer"><p>β
Amino acids </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question">3) Name the portion of the myofibril between two successive Z-lines. <p> a. H-zone b. Sarcomere <p> c. I-band d. M-line </div>
<div class="answer"><p>β
(b) Sarcomere </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> 4) Identify the word pair applicable to phylum Ctenophora. <p> a. Nephridia, Parapodia <p> b. Comb plates, Bioluminescence <p> c. Polyp, Metagenesis <p> d. Radula, Visceral hump </div>
<div class="answer"> <p>β
(b) Comb plates, Bioluminescence </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question">5) Unit of classification is <p> a. Taxon b. Species <p> c. Genus d. Cell </div>
<div class="answer"><p>β
(a) Taxon </div>
<button class="answer-button">View Answer</button>
</div>
<p style="font-size: 18px; font-family: Arial; text-align: left; color: #5c5c5c; background-color: #ebeaec; padding: 10px;"> <b> <i>II. Answer any 9 questions from 6 β 16. Each carries 2 scores. (9 x 2 = 18)</i> </b> </p>
<div class="box">
<div class="question"> 6) Cells of human body perform different types of movement. Write any two types of movement and the parts that exhibit the movement. </div>
<div class="answer"> <p>β
<b>Answer</b></p> <b>Amoeboid movement:</b> E.g. Macrophages & leucocytes. <p> <b>Ciliary movement:</b> E.g. ciliary movements in trachea. </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> 7) Find out the suitable term from the box for the disorders stated. <p> i. Accumulation of Urea in blood. <p> ii. Insoluble mass of crystallised salts in the kidney. <p> iii. Surgical method for the correction of Renal failures. <p> iv. Inflammation of glomeruli of kidney. <p> <center> Dialysis, Kidney transplantation, Glomerulonephritis, Uremia, Renal Calculi </center></div>
<div class="answer"> <p>β
<b>Answer</b></p> <blockquote>i. Uraemia <p> ii. Renal calculi <p> iii. Kidney transplantation <p> iv. Glomerulonephritis</blockquote> </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> 8) Characteristics of certain animals are given. Arrange them under the Class to which these animals belong. <p> i. Skin is moist without scales. <p> ii. Body is covered by dry and cornified skin. <p> iii. Shed the scales as skin cast. <p> iv. Can live in aquatic as well as terrestrial habitats. </div>
<div class="answer"> <p>β
<b>Answer</b></p> Class Amphibia: (i) & (iv) <p> Class Reptilia: (ii) & (iii) </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> 9) When substrate concentration increases, the velocity of enzymatic reaction increases at first. After attaining a maximum velocity, it cannot be exceeded by further addition of substrates. Why? </div>
<div class="answer"> <p>β
<b>Answer</b></p> Because enzyme molecules are fewer than the substrate molecules i.e. No free enzyme molecules to bind with additional substrate molecules. </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> 10) Distinguish between non-Chordata and Chordata. (Any two differences). </div>
<div class="answer"> <p>β
<b>Answer</b></p> <b>Chordata: </b>Notochord is present, Pharyngeal gill slits are present. <p> <b>Non-Chordata:</b> Notochord is absent, Pharyngeal gill slits are absent. </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> 11) Distinguish between the following terms: <p> a. IRV, ERV <p> b. Tidal volume, Residual volume </div>
<div class="answer"> <p>β
<b>Answer</b></p> (a) <b>IRV: </b>Additional volume of air a person can inspire by a forcible inspiration. <p> <b>ERV:</b> Additional volume of air a person can expire by a forcible expiration. <p> (b) <b>Tidal Volume:</b> Vole of air inspired or expired during normal respiration. <p> <b>Residual volume:</b> Volume of air remaining in the lungs after a forcible expiration. </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> 12) Give one word for the following: <p> (i) The nucleic acid that behave like enzymes. <p> (ii) The protein part of the enzyme. <p> (iii) The organic compound tightly bound to the apoenzyme. <p> (iv) The organic compound that are loosely bound to the apoenzyme. </div>
<div class="answer"> <p>β
<b>Answer</b></p> (i) Ribozymes <p> (ii) Apoenzyme <p> (iii) Prosthetic group <p> (iv) Coenzymes </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> 13) ANF is a regulatory mechanism in kidney functioning. <p> (a) Expand ANF. <p> (b) Which part of the body secrete ANF? <p> (c) Explain the regulatory mechanism. </div>
<div class="answer"> <p>β
<b>Answer</b></p> (a) Atrial Natriuretic Factor <p> (b) Atria of the heart <p> (c) ANF is released when blood flow to the atria is increased. It causes vasodilation (dilation of blood vessels) to decrease the blood pressure. </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> 14) 'Adrenal medulla is the centrally located tissue in the adrenal gland, whereas adrenal cortex is located outside. <p> How do adrenal cortex and medulla differ in their function? </div>
<div class="answer"> <p>β
<b>Answer</b></p> <b>Adrenal cortex: </b>Secretes corticoid hormones for carbohydrate metabolism etc. <p> <b>Adrenal medulla:</b> Secretes adrenaline and noradrenaline (emergency hormones). </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> 15) a) Draw a flowchart showing the correct sequence of various parts of frogβs alimentary canal. <p> b) Name the location of finger-like villi and microvilli and mention their function. </div>
<div class="answer"> <p>β
<b>Answer</b></p> a) Mouth β buccal cavity β pharynx β oesophagus β stomach β intestine β rectum β cloaca. <p> b) Intestine. They absorb digested food. </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> 16) Name any two plasma proteins and state their functions. </div>
<div class="answer"> <p>β
<b>Answer</b></p> <b>Fibrinogen:</b> For blood coagulation. <p> <b>Globulins:</b> Act as antibodies. <p> <b>Albumins:</b> For osmotic balance. Regulate blood pressure. </div>
<button class="answer-button">View Answer</button>
</div>
<p style="font-size: 18px; font-family: Arial; text-align: left; color: #5c5c5c; background-color: #ebeaec; padding: 10px;"> <b> <i>III. Answer any 3 questions from 17 β 20. Each carries 3 scores. (3 x 3 = 9)</i> </b> </p>
<div class="box">
<div class="question"> 17) Observe the diagram. <div class="separator" style="clear: both;"><a href="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEjB5yNkrj408SqDntCv5nMa5QjItfpQz15X6D5MCmJ5o2GY9c_9LS3DlApuQ_hn7c4c41WYJ-1I3rJ7bXwGiugzGA-DHsQDv9hzFMIlJa75XmOfQKCR55aOTZFJAex-98WRz959yLjSmntpwwCIFHUAqup1l-vMTYIOhPvv_JYIsh42wfj4CMg4F0DlzQM/s1600/bob.jpg" style="display: block; padding: 0; text-align: center; "><img alt="" border="0" data-original-height="169" data-original-width="402" src="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEjB5yNkrj408SqDntCv5nMa5QjItfpQz15X6D5MCmJ5o2GY9c_9LS3DlApuQ_hn7c4c41WYJ-1I3rJ7bXwGiugzGA-DHsQDv9hzFMIlJa75XmOfQKCR55aOTZFJAex-98WRz959yLjSmntpwwCIFHUAqup1l-vMTYIOhPvv_JYIsh42wfj4CMg4F0DlzQM/s1600/bob.jpg"/></a></div> a. What does it denote? <p> b. What do P, QRS, T represent? <p> c. What is its clinical significance? </div>
<div class="answer"> <p>β
<b>Answer</b></p> (a) ECG. <p> (b) <b>P wave:</b> Depolarization of atria. <p> <blockquote><b>QRS wave:</b> Depolarization of ventricles. <p> <b>T-wave:</b> Repolarization of ventricles.</blockquote> <p> (c) It is used to find out the deviation or abnormality of functioning of heart. </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> 18) Compete the given table appropriately. <div class="separator" style="clear: both;"><a href="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEhgvB1vRObtXyMFu63-_mQAX9I7FxuYPnjorK_Vr1j6st9D6SiWMUXIQTdGSP-IVBF3zVzsVH2d1Q_1m2rLyHQC1jOCrcRco-xc4rSZ7xzvzonp7m71Ggeq7JFG-83qAGJlHivtcUVdvhgANdCQ7jVLcj4Qa2dwpy-OZzV6ybR9yerkqwqBV89gSNTQQgc/s1600/bob.jpg" style="display: block; padding: 0; text-align: center; "><img alt="" border="0" data-original-height="280" data-original-width="567" src="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEhgvB1vRObtXyMFu63-_mQAX9I7FxuYPnjorK_Vr1j6st9D6SiWMUXIQTdGSP-IVBF3zVzsVH2d1Q_1m2rLyHQC1jOCrcRco-xc4rSZ7xzvzonp7m71Ggeq7JFG-83qAGJlHivtcUVdvhgANdCQ7jVLcj4Qa2dwpy-OZzV6ybR9yerkqwqBV89gSNTQQgc/s1600/bob.jpg"/></a></div> </div>
<div class="answer"> <p>β
<b>Answer</b></p> (A) Testis <p> (B) Thymosin <p> (C) Provides immunity. <p> (D) Pancreas <p> (E) Melatonin <p> (F) Diurnal rhythm. </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> 19) Observe the figures. <div class="separator" style="clear: both;"><a href="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEidMlVzsX5s7xobdtz8ACcE50uZ7hwYc2UX7aNA69BmmU6gR-135WjY293NdsGO6CMm5zLRTCD-LwuZXc2sjv3g4yXIad6klLOxNAsuu3AZVyC69FEJwGgqoShbjTPQz3HyaxLYcdB1Cj8-lt5waG4wxvxokbSPsmUH-tIAhz6IfPep2Q3R6K8GlIdyLuA/s1600/bob.jpg" style="display: block; padding: 0; text-align: center; "><img alt="" border="0" data-original-height="450" data-original-width="438" src="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEidMlVzsX5s7xobdtz8ACcE50uZ7hwYc2UX7aNA69BmmU6gR-135WjY293NdsGO6CMm5zLRTCD-LwuZXc2sjv3g4yXIad6klLOxNAsuu3AZVyC69FEJwGgqoShbjTPQz3HyaxLYcdB1Cj8-lt5waG4wxvxokbSPsmUH-tIAhz6IfPep2Q3R6K8GlIdyLuA/s1600/bob.jpg"/></a></div> a. Identify the organisms A, B & C. <p> b. Name the phylum to which each of them belongs. </div>
<div class="answer"> <p>β
<b>Answer</b></p> (a) A= <i>Balanoglossus</i>, B= <i>Neries</i>, C= Liver fluke (<i>Fasciola</i>). <p> (b) A= Hemichordata, B= Annelida, C= Platyhelminthes. </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> 20) Match the following: <div class="separator" style="clear: both;"><a href="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEheqhafC_ZGexzivCXjKb-7zAJfL4ESHyPYO4gyVK2uiZTwq215lZsMXwwDINPE-u1RqRqeQ3zYhQzY0jemqezYkynVEU-6CC7EDTnpGCsCgfBpkwqZ0LtMx06x59sFRQOCZTdV2shcWMxIbtfdVcf-5iy-Bdyb-HIkSnUVpbsx9ss2vdthyt7m5vxVp8M/s1600/bob.jpg" style="display: block; padding: 0; text-align: center; "><img alt="" border="0" data-original-height="501" data-original-width="673" src="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEheqhafC_ZGexzivCXjKb-7zAJfL4ESHyPYO4gyVK2uiZTwq215lZsMXwwDINPE-u1RqRqeQ3zYhQzY0jemqezYkynVEU-6CC7EDTnpGCsCgfBpkwqZ0LtMx06x59sFRQOCZTdV2shcWMxIbtfdVcf-5iy-Bdyb-HIkSnUVpbsx9ss2vdthyt7m5vxVp8M/s1600/bob.jpg"/></a></div> </div>
<div class="answer"> <p>β
<b>Answer</b></p> <div class="separator" style="clear: both;"><a href="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEgAJMBVsfNxtO1aNdLIcBEZgzrPVEfqrHNIr1gB15XuOZngN2mlczm2vHqLL6jpUgaPfJESSqCOrWyRYgPu9s0u0IOf-7jeYdT1qJN9p2A2KAySAbtpicGqCZ8ydWPTBJN8jcY28vLskkaNne7kTJvGHOiVZ_9KE-e_O_hw7jz-lvDrZoCE2Ptd6zw1GeM/s1600/bob2.png" style="display: block; padding: 0; text-align: center; "><img alt="" border="0" data-original-height="349" data-original-width="450" src="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEgAJMBVsfNxtO1aNdLIcBEZgzrPVEfqrHNIr1gB15XuOZngN2mlczm2vHqLL6jpUgaPfJESSqCOrWyRYgPu9s0u0IOf-7jeYdT1qJN9p2A2KAySAbtpicGqCZ8ydWPTBJN8jcY28vLskkaNne7kTJvGHOiVZ_9KE-e_O_hw7jz-lvDrZoCE2Ptd6zw1GeM/s1600/bob2.png"/></a></div> </div>
<button class="answer-button">View Answer</button>
</div>
<script>
// Get all the answer buttons
const answerButtons = document.querySelectorAll('.answer-button');
// Add a click event listener to each answer button
answerButtons.forEach(button => {
button.addEventListener('click', () => {
// Get the answer section for this button
const answerSection = button.previousElementSibling;
// Toggle the answer section's visibility
answerSection.classList.toggle('visible');
// Change the button text to "Hide Answer" or "View Answer"
if (answerSection.classList.contains('visible')) {
button.textContent = 'Hide Answer';
button.classList.add('hide-answer');
} else {
button.textContent = 'View Answer';
button.classList.remove('hide-answer');
}
});
});
</script>
<html>
<head>
<style>
.special-paragraph {
margin-bottom: -10px; /* Adjust this value to reduce the space */
color: #333333;
font-family: Arial, sans-serif;
font-size: 23px;
font-weight: bold;
line-height: 1.5;
padding: 7px;
text-align: center;
border-radius: 10px;
}
.green-bg {
background-color: #ddffd9; /* Green background */
}
.blue-bg {
background-color: #b0eaff; /* Blue background */
}
</style>
</head>
<body>
<p class="special-paragraph green-bg">
<a href="https://www.bankofbiology.com/2020/10/hse-1-2-model-qp-online-exam-series.html" style="color: green;"> π Other Question Papers </a>
</p>
<p class="special-paragraph blue-bg">
<a href="https://www.bankofbiology.com/p/question-bank.html" style="color: blue;"> π Exam Special Materials </a>
</p>
</body>
</html>
<div class="blogger-post-footer"><p> Β© copyright 2024 β All rights reserved </p>
<a href=βhttps://www.bankofbiology.comβ>bankofbiology.com</a></div>Abu Raniyahttp://www.blogger.com/profile/14189496606355139812noreply@blogger.com0tag:blogger.com,1999:blog-6823671394482492613.post-24818167876424058292024-03-17T07:52:00.003+05:302024-03-17T11:24:59.312+05:30Exam Capsule Slides PPT and PDF | Ecosystems | Class 12<h1 style="text-align: center;">
<span style="color: #cc0000;">Exam Capsule PPT </span><br />
</h1>
<h1 style="text-align: center;">
<span style="color: #0b5394;"
>Ecosystems</span>
</h1>
<iframe src="https://docs.google.com/presentation/d/e/2PACX-1vTtSa2WtBfNE3gvUZOtp7CEilJ7jIIfK-XxJLABtlQt8Euf0SJGrhhHegnqcskVZQ/embed?start=true&loop=false&delayms=5000" frameborder="0" width="100%" height="400" allowfullscreen="true" mozallowfullscreen="true" webkitallowfullscreen="true"></iframe>
<h1 style="text-align: center;">π <a href="https://docs.google.com/presentation/d/1Dd-HoqCd7VLMTM7EurgjobbW823xoGNm/edit?usp=sharing&ouid=103337463072223242758&rtpof=true&sd=true" target="_blank">Download PPT version</a> </h1>
<div><h1 style="text-align: center;">π <a href="https://drive.google.com/file/d/1DYeFDJGYVAR4aJQ9UGOu_Urs4CuiBWCC/view?usp=sharing" target="_blank">Download PDF version</a> </h1></div>
<div><br /></div>
<div class="blogger-post-footer"><p> Β© copyright 2024 β All rights reserved </p>
<a href=βhttps://www.bankofbiology.comβ>bankofbiology.com</a></div>Abu Raniyahttp://www.blogger.com/profile/14189496606355139812noreply@blogger.com0tag:blogger.com,1999:blog-6823671394482492613.post-52658711554781569372024-03-17T07:52:00.002+05:302024-03-17T11:17:12.807+05:30Exam Capsule Slides PPT and PDF | Organisms and Populations | Class 12<h1 style="text-align: center;">
<span style="color: #cc0000;">Exam Capsule PPT </span><br />
</h1>
<h1 style="text-align: center;">
<span style="color: #0b5394;"
>Organisms and Populations</span>
</h1>
<iframe src="https://docs.google.com/presentation/d/e/2PACX-1vRGmO_CwboPZEaFG_s1CWbEB_IznnK9njbkUx_ScFKu7NL86tTTwYdnOHAHF063pQ/embed?start=true&loop=false&delayms=5000" frameborder="0" width="100%" height="400" allowfullscreen="true" mozallowfullscreen="true" webkitallowfullscreen="true"></iframe>
<h1 style="text-align: center;">π <a href="https://docs.google.com/presentation/d/1DXizHjtK1vBR5d6oPoVMHc7UEfvqGtGj/edit?usp=sharing&ouid=103337463072223242758&rtpof=true&sd=true" target="_blank">Download PPT version</a> </h1>
<div><h1 style="text-align: center;">π <a href="https://drive.google.com/file/d/1DLXVlyVtZ58yjpvexFdlrxnY3Q0_gylJ/view?usp=sharing" target="_blank">Download PDF version</a> </h1></div>
<div><br /></div>
<div class="blogger-post-footer"><p> Β© copyright 2024 β All rights reserved </p>
<a href=βhttps://www.bankofbiology.comβ>bankofbiology.com</a></div>Abu Raniyahttp://www.blogger.com/profile/14189496606355139812noreply@blogger.com0tag:blogger.com,1999:blog-6823671394482492613.post-19848676374642768042024-03-16T06:31:00.088+05:302024-03-16T20:19:40.949+05:30Plus Two Biology (Bot + Zoo) | Practice Model Question Paper PDF with Answer key | SET 10<!DOCTYPE html>
<html>
<head>
<title>Example Webpage</title>
<style>
body {
user-select: none; /* Prevent selection of text */
-moz-user-select: none; /* Firefox */
-webkit-user-select: none; /* Safari and Chrome */
-ms-user-select: none; /* Internet Explorer/Edge */
}
h1 {
user-select: text; /* Allow selection of title */
}
</style>
</head>
<p style="font-size: 25px; font-family: Arial; text-align: center; color: #2068d4; line-height: 1.5;"> <b> π <a href="https://drive.google.com/file/d/1DFvK5LkflDeu45FeLgGTCAVUEn_MsY43/view?usp=sharing" target="_blank">Download Biology Question Paper PDF - SET 10</a> </b> </p>
<style>
/* Customize the box style */
.box {
background-color: #ffffff;
border: 1px solid #ffffff;
border-radius: 1px;
padding: 10px;
margin-bottom: 10px;
margin-right: -14px;
margin-left: -14px;
}
/* Customize the question style */
.question {
font-size: 17px;
font-weight: bold;
color: #3D4849;
font-family: Open Sans;
margin-bottom: 10px;
}
/* Customize the answer style */
.answer {
font-size: 18px;
font-weight: normal;
font-family: Roboto;
margin-bottom: 10px;
background-color: #e7ffde;
}
/* Hide the answer by default */
.answer {
display: none;
}
/* Customize the view/hide answer button */
.answer-button {
background-color: #4CAF50;
border: none;
border-radius: 5px;
color: white;
padding: 8px 16px;
text-align: center;
text-decoration: none;
display: inline-block;
font-size: 18px;
margin-bottom: 1px;
cursor: pointer;
}
/* Style the button differently when it changes to "Hide Answer" */
.answer-button.hide-answer {
background-color: #f44336;
}
/* Show the answer when the visible class is added */
.answer.visible {
display: block;
}
.table-text {
display: grid;
grid-template-columns: 50% 50%;
grid-gap: none;
margin-top: 5px;
border-collapse: collapse;
}
.table-text-2 {
display: grid;
grid-template-columns: 33.33% 33.33% 33.33%;
grid-gap: none;
margin-top: 5px;
border-collapse: collapse;
}
.table-text-header,
.table-text-cell {
padding: 5px;
border: 1px solid black;
text-align: left;
}
.table-text-header {
font-weight: bold;
text-align: center;
}
.no-break {
white-space: nowrap;
}
.tab {
text-indent: 40px; /* Adjust the value as per your preference */
}
blockquote {
background: none; /* Remove background color */
border: none; /* Remove border */
margin: 0; /* Remove default margin */
padding: 0 0 0 20px; /* Retain padding on the left side */
quotes: none; /* Remove quote marks */
}
blockquote:before {
content: none; /* Remove quote marks */
}
</style>
<p style="font-size: 30px; font-family: Arial; text-align: center; color: #0c8a7d; background-color: #a2f5d3; padding: 10px;"> <b> PART A: BOTANY </b></p>
<p style="font-size: 18px; font-family: Arial; text-align: left; color: #5c5c5c; background-color: #ebeaec; padding: 10px;"> <b> <i>I. Answer any 3 questions from 1 β 5. Each carries 1 score. (3 x 1 = 3)</i> </b> </p>
<div class="box">
<div class="question">1) By observing the relationship of the first pair fill up the blanks: <p> GFC: Producers and consumers <p> DFC: Dead organic matter and β¦β¦β¦β¦β¦β¦. </div>
<div class="answer"><p>β
Decomposers </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question">2) The size of a population is not static. Which of the following leads to decrease in population? <p> a) Natality & Mortality <p> b) Mortality & Emigration <p> c) Mortality & Immigration <p> d) Natality & Immigration </div>
<div class="answer"><p>β
b) Mortality & Emigration </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question">3) Development of fruit without fertilization and are seedless known as <p> a. Polyembryony b. Apomixis <p> c. Parthenocarpy d. Parthenogenesis </div>
<div class="answer"><p>β
c) Parthenocarpy </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> 4) What is the function of <i>Restriction Endonuclease</i> in recombinant DNA technology? <p> a. Link together fragments of DNA <p> b. Make millions of copies of DNA <p> c. Cut DNA into many fragments <p> d. Separate fragments of DNA </div>
<div class="answer"> <p>β
(c) Cut DNA into many fragments </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question">5) Vitamin βAβ enriched rice is called β¦β¦β¦β¦β¦β¦. </div>
<div class="answer"><p>β
Golden rice </div>
<button class="answer-button">View Answer</button>
</div>
<p style="font-size: 18px; font-family: Arial; text-align: left; color: #5c5c5c; background-color: #ebeaec; padding: 10px;"> <b> <i>II. Answer any 9 questions from 6 β 16. Each carries 2 scores. (9 x 2 = 18)</i> </b> </p>
<div class="box">
<div class="question"> 6) Distinguish between true fruit and false fruit with examples. </div>
<div class="answer"> <p>β
<b>Answer</b></p> <b>True fruits: </b>In this, fruit develops only from the ovary. Other floral parts degenerate & fall off. E.g. most plants. <p> <b>False fruits: </b>In this, the thalamus also contributes to fruit formation. E.g. apple, strawberry, cashew etc.
</div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> 7) A population has certain attributes that an individual organism does not. What are they? </div>
<div class="answer"> <p>β
<b>Answer</b></p> Natality, mortality, sex ratio, age distribution, population density. </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> 8) Parasites evolved special adaptations to live on host. What are they? </div>
<div class="answer"> <p>β
<b>Answer</b></p> Parasitic adaptations: <p> βͺοΈ High reproductive capacity. <p> βͺοΈ Presence of suckers. <p> βͺοΈ Digestive system absent. </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> 9) A multinational company successfully cloned a gene of interest and also optimized the conditions to induce the expression of target protein. <p> a. Name the apparatus for large scale production of such proteins. <p> b. Briefly explain the apparatus. </div>
<div class="answer"> <p>β
<b>Answer</b></p> (a) Bioreactors. <p> (b) These are the vessels in which raw materials are biologically converted to specific products, enzymes etc., using microbial, plant, animal or human cells. Bioreactors are used to produce large quantities of products. They can process 100-1000 litres of culture.
</div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> 10) There are many features required to facilitate successful cloning into a vector. Write shortly any two such features required by a vector. </div>
<div class="answer"> <p>β
<b>Answer</b></p> <b>i. Origin of replication (<i>ori</i>):</b> This is a sequence where replication starts. A piece of DNA linked to ori can replicate within the host cells. This also controls the copy number of linked DNA. <p> <b>ii. Selectable marker (marker gene):</b> It is a gene that helps to select the transformants and eliminate the non-transformants. If a piece of DNA is introduced in a host bacterium, it is called transformation. Selectable markers of <i>E. coli</i> include the genes encoding resistance to antibiotics like ampicillin, tetracycline, etc. </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> 11) The early stages of embryo development are similar in both dicots and monocots. However, mature embryos have differences. Write two major differences between dicot embryo and monocot embryo. </div>
<div class="answer"> <p>β
<b>Answer</b></p> <b>Differences between dicot embryo and monocot embryo: <div class="separator" style="clear: both;"><a href="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEiuD6SQLQhTIb7Ktww_dStsYmbYnJUOEp2Q4zvbBPCRASU-acBnuy1FVP2S2QnT5xxH8w3c_IsPXNUHWzjl0eDfoM5Z7R7LSo3KHBFgoPwHnEFk87I33-0lI7fRLrsvPOjHIi1EkIHXpOIhJogPFTIQO4SkpEuDhWpEGw50bA9aC1UTQBZuNDL6HhrDWEs/s1600/bob2.png" style="display: block; padding: 1em 0; text-align: center; "><img alt="" border="0" data-original-height="107" data-original-width="400" src="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEiuD6SQLQhTIb7Ktww_dStsYmbYnJUOEp2Q4zvbBPCRASU-acBnuy1FVP2S2QnT5xxH8w3c_IsPXNUHWzjl0eDfoM5Z7R7LSo3KHBFgoPwHnEFk87I33-0lI7fRLrsvPOjHIi1EkIHXpOIhJogPFTIQO4SkpEuDhWpEGw50bA9aC1UTQBZuNDL6HhrDWEs/s1600/bob2.png"/></a></div> </b> </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> 12) What is meant by insertional inactivation in biotechnology? Mention its importance. </div>
<div class="answer"> <p>β
<b>Answer</b></p> When a foreign DNA is inserted within a gene of bacteria, that gene is inactivated. It is called insertional inactivation. E.g., the recombinant plasmids lose tetracycline resistance due to insertion of foreign DNA. <p> <b>Importance:</b> It allows for the selection of cells that have taken up the foreign DNA, distinguishing them from those that have only taken up empty plasmids.
</div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> 13) A farmer approached an Agriculture officer to tell his grievance i.e., reduction in tobacco yield due to root damage by nematodes. <p> a. What is your suggestion to prevent this infestation? <p> b. Briefly explain the process. </div>
<div class="answer"> <p>β
<b>Answer</b></p> (a) It can be prevented by RNA interference (RNAi) strategy. <p> (b) RNAi is a method of cellular defense in all eukaryotic organisms. It prevents translation of a specific mRNA (silencing) due to a complementary dsRNA molecule.
</div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> 14) (a) Identify the type of ecological pyramid given below. <div class="separator" style="clear: both;"><a href="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEhh1phofuTErhbqFnDMRz0an0hJbSi1nPKH9h-fqXh4SOrCuZHQG6OLmc4MSkcOY3yV2yCzaGcE_kqo8qOqu9GA4wTFvq_uU3OV1DqpGI2xFMwvjEIAChz7eOMzKiVkCP_HuGSBZkeDNu7rquhmkAIwLHp0TGt8TnWCXK_5E-qDqiWFZCWDncGbNBlZ72o/s1600/bob.jpg" style="display: block; padding: 1em 0; text-align: center; "><img alt="" border="0" data-original-height="439" data-original-width="615" src="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEhh1phofuTErhbqFnDMRz0an0hJbSi1nPKH9h-fqXh4SOrCuZHQG6OLmc4MSkcOY3yV2yCzaGcE_kqo8qOqu9GA4wTFvq_uU3OV1DqpGI2xFMwvjEIAChz7eOMzKiVkCP_HuGSBZkeDNu7rquhmkAIwLHp0TGt8TnWCXK_5E-qDqiWFZCWDncGbNBlZ72o/s1600/bob.jpg"/></a></div> <p> (b) Pyramid of energy is always upright. Why? </div>
<div class="answer"> <p>β
<b>Answer</b></p> (a) Pyramid of biomass. <p> (b) Energy flows from a trophic level to next higher trophic level, only 10% of energy of a trophic level will be transferred to next higher trophic level.
</div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> 15) Detritivores play a major role in decomposition. <p> a. What are detritivores? <p> b. Write an example for a detritivore. </div>
<div class="answer"> <p>β
<b>Answer</b></p> (a) Detritivores are the organisms that breaks detritus to smaller particles. <p> (b) Earthworm, termites etc.
</div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> 16) Analyse the following table showing population interaction: <div class="separator" style="clear: both;"><a href="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEj8QnJmS4dVXYNuX_iHHtBC_7OT-W9RUPCBh2Q4Iw5yJ12JMJYSX5x00938KsimHaPEq3JZjgfo2yrAH6YSH9T8glmfUT-uTI5BmGG5fudeYAKKf7y6cDEEcp9OOMjLxqeJRtbcL4LD7iSRW2LrqxOR8S2vUlfltd7kqduIEIS7Qj3s_e6vA4k3qY6byGI/s1600/bob2.png" style="display: block; padding: 1em 0; text-align: center; "><img alt="" border="0" data-original-height="93" data-original-width="350" src="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEj8QnJmS4dVXYNuX_iHHtBC_7OT-W9RUPCBh2Q4Iw5yJ12JMJYSX5x00938KsimHaPEq3JZjgfo2yrAH6YSH9T8glmfUT-uTI5BmGG5fudeYAKKf7y6cDEEcp9OOMjLxqeJRtbcL4LD7iSRW2LrqxOR8S2vUlfltd7kqduIEIS7Qj3s_e6vA4k3qY6byGI/s1600/bob2.png"/></a></div> a. Identify (i) and (ii). <p> b. Define (ii).
</div>
<div class="answer"> <p>β
<b>Answer</b></p> (a) i. 0 ii. Mutualism. <p> (b) Mutualism is the interaction that confers benefits for both interacting species.
</div>
<button class="answer-button">View Answer</button>
</div>
<p style="font-size: 18px; font-family: Arial; text-align: left; color: #5c5c5c; background-color: #ebeaec; padding: 10px;"> <b> <i>III. Answer any 3 questions from 17 β 20. Each carries 3 scores. (3 x 3 = 9)</i> </b> </p>
<div class="box">
<div class="question"> 17) Bt cotton is a transgenic pest resistant plant. <p> a. How this was achieved? <p> b. How does this plant survive on pest attack? </div>
<div class="answer"> <p>β
<b>Answer</b></p> (a) Bt toxin gene is isolated from <i>Bacillus thuringiensis</i> and incorporated into cotton plant to form Bt cotton. <p> (b) When an insect ingests the toxin in Bt cotton, it becomes active. Toxin binds to surface of mid-gut epithelial cells creating pores. It causes cell swelling and lysis and death of the insect.
</div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> 18) Egg cell formation in angiosperms involves megasporogenesis and female gametophyte development. <p> a. Briefly write the various steps involved in female gametophyte development. <p> b. Mature angiosperm embryo sac at maturity is 8 nucleated but 7 celled. What is your explanation related to this statement? </div>
<div class="answer"> <p>β
<b>Answer</b></p> (a) In majority of flowering plants, one megaspore is functional while the other three degenerates. <p> The functional megaspore develops into the female gametophyte. <p> Nucleus of the functional megaspore divides mitotically to form two nuclei. They move to the opposite poles, forming 2-nucleate embryo sac. <p> The nuclei again divide two times forming 4-nucleate and 8-nucleate stages of the embryo sac. <p> (b) 6 of the 8 nuclei are surrounded by cell walls and organized into cells. Remaining 2 nuclei (polar nuclei) are situated below the egg apparatus in the large central cell.
</div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> 19) Observe the following diagram. <div class="separator" style="clear: both;"><a href="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEgeENRyGsXfozTnr6WT_APqHExsliHsoD50wqTzS6IFjVlwDAzh_uGJmSaabzPgF1OmsjBm3CtN2Id3yMHnrVCfweXhQSWub2yCKyuhXCStrLt4ivhzMP1YcSIW4ZpMA8tUFZbg1OPdtV5yysDKSbrEee7WMtqepOM130Y7KLhd6ppusI-wUzLkERNT5rU/s1600/bob.jpg" style="display: block; padding: 1em 0; text-align: center; "><img alt="" border="0" data-original-height="285" data-original-width="400" src="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEgeENRyGsXfozTnr6WT_APqHExsliHsoD50wqTzS6IFjVlwDAzh_uGJmSaabzPgF1OmsjBm3CtN2Id3yMHnrVCfweXhQSWub2yCKyuhXCStrLt4ivhzMP1YcSIW4ZpMA8tUFZbg1OPdtV5yysDKSbrEee7WMtqepOM130Y7KLhd6ppusI-wUzLkERNT5rU/s1600/bob.jpg"/></a></div> a. Identify the figure. <p> b. Label A, B and C. <p> c. Mention two types of restriction enzymes. </div>
<div class="answer"> <p>β
<b>Answer</b></p> (a) Steps in formation of recombinant DNA by EcoRI. <p> (b) A= Vector DNA <p> B= EcoRI <p> C= Sticky end <p> (c) <b>(i) Exonucleases: </b>They remove nucleotides from the ends of the DNA. <p> <b>(ii) Endonucleases:</b> They cut at specific positions within the DNA.
</div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> 20) Decomposition is a process by which decomposers break down complex organic matter into inorganic substances like carbon dioxide, water and nutrients. Briefly explain the five steps of decomposition. </div>
<div class="answer"> <p>β
<b>Answer</b></p> <b>Steps of decomposition:</b> <p> <b>a. Fragmentation:</b> It is the breakdown of detritus into smaller particles by detritivores (e.g. earthworm). <p> <b>b. Leaching:</b> Water soluble inorganic nutrients go down into soil horizon and precipitate as unavailable salts. <p> <b>c. Catabolism:</b> Degradation of detritus into simpler inorganic substances by bacterial and fungal enzymes. <p> <b>d. Humification:</b> Accumulation of humus (dark amorphous substance) in soil. Humus is resistant to microbial action and so decomposes very slowly. Being colloidal, it serves as a reservoir of nutrients. <p> <b>e. Mineralization:</b> It is the release of inorganic nutrients due to the degradation of humus by some microbes.
</div>
<button class="answer-button">View Answer</button>
</div>
<p style="font-size: 30px; font-family: Arial; text-align: center; color: #993d77; background-color: #ffe0f4; padding: 10px;"> <b> PART B: ZOOLOGY </b></p>
<p style="font-size: 18px; font-family: Arial; text-align: left; color: #5c5c5c; background-color: #ebeaec; padding: 10px;"> <b> <i>I. Answer any 3 questions from 1 β 5. Each carries 1 score. (3 x 1 = 3)</i> </b> </p>
<div class="box">
<div class="question">1) The family of Queen Victoria shows a number of haemophilic descendants as she was the carrier of the disease. Name the pattern of inheritance of this royal disease. </div>
<div class="answer"><p>β
Sex-linked (X-linked) recessive disease. </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question">2) Identify the ancestor species of human being from the following features: <p> a. First human-like being (hominid). Brain capacity: 650-800 cc. Did not eat meat. <p> b. Large brain of 900 cc. Ate meat. </div>
<div class="answer"><p>β
(a) <i>Homo habilis</i> (b) <i>Homo erectus</i> </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question">3) Note the relation between first two terms and fill in the blanks. <p> a. <i>Erythroxylum coca</i>: Cocaine <p> <i>Papaver somniferum</i>: β¦β¦β¦β¦β¦β¦. <p> b. Benign tumour: Do not spread <p> β¦β¦β¦β¦β¦β¦.: Spread to other parts </div>
<div class="answer"><p>β
(a) Opium (b) Malignant tumour </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> 4) The packaging of chromatin at higher level requires additional set of proteins called β¦β¦β¦β¦β¦β¦. </div>
<div class="answer"> <p>β
Non-histone Chromosomal (NHC) proteins. </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question">5) Rearrange the following in correct sequence: <p> <center>Mammary tubules β mammary alveoli β lactiferous duct β mammary ampulla β mammary duct </center></div>
<div class="answer"><p>β
Mammary alveoli β Mammary tubules β mammary duct β mammary ampulla β lactiferous duct </div>
<button class="answer-button">View Answer</button>
</div>
<p style="font-size: 18px; font-family: Arial; text-align: left; color: #5c5c5c; background-color: #ebeaec; padding: 10px;"> <b> <i>II. Answer any 9 questions from 6 β 16. Each carries 2 scores. (9 x 2 = 18)</i> </b> </p>
<div class="box">
<div class="question"> 6) Complete the table by filling a, b, c and d. <div class="separator" style="clear: both;"><a href="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEhwOnrpHmx5QhbgC2tnI-zwa6_0Una_z6lDS-dTIgqrW1JqULkiKvzdkVvJl6RJ6if7VLLirDt8klcU4cZljyuznCEoMxduzkQLI67TR5zyn4inxF8QoaX-hY1nYeQtdOZGPL0cSbfg_XKfUUh6FPitK2snzteXWEoytM9CBuWDrCgHhhbHgPPetrcBtUs/s1600/bob2.png" style="display: block; padding: 1em 0; text-align: center; "><img alt="" border="0" data-original-height="116" data-original-width="500" src="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEhwOnrpHmx5QhbgC2tnI-zwa6_0Una_z6lDS-dTIgqrW1JqULkiKvzdkVvJl6RJ6if7VLLirDt8klcU4cZljyuznCEoMxduzkQLI67TR5zyn4inxF8QoaX-hY1nYeQtdOZGPL0cSbfg_XKfUUh6FPitK2snzteXWEoytM9CBuWDrCgHhhbHgPPetrcBtUs/s1600/bob2.png"/></a></div> </div>
<div class="answer"> <p>β
<b>Answer</b></p> (a) <i>Streptococcus pneumoniae</i> <p> (b) <i>Rhinovirus</i> <p> (c) Malaria <p> (d) Deformity of limbs & genital organs </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> 7) The list given below includes various stages of HIV infection. Arrange them according to correct sequence. <p> <center>Viral replication β Macrophage - Helper T cell β Formation of DNA β Progeny virus β Viral particle β Release of progeny virus </center></div>
<div class="answer"> <p>β
<b>Answer</b></p> Viral particle β Macrophage β Formation of DNA β Viral replication β Helper T cell β Progeny virus β Release of progeny virus </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> 8) Observe the picture given below: <div class="separator" style="clear: both;"><a href="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEjZeBI0U636oK0AzHbzLqhOnAgIYauIxzQxoTo5N2UewsTKNO3KJEgaoFS-1-bglcwaWj84NWC0mQiszuyxoPHL3qy6NjzWyJmQn5-3KAuFZSlGePPJz46GVh3hXSZBen0BcUQdVzyr7S941B6V4x7v4gNuYipiBv7j5sbWURwmtx0jeFOEEuX9b2AfpIo/s1600/bob.jpg" style="display: block; padding: 1em 0; text-align: center; "><img alt="" border="0" data-original-height="239" data-original-width="600" src="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEjZeBI0U636oK0AzHbzLqhOnAgIYauIxzQxoTo5N2UewsTKNO3KJEgaoFS-1-bglcwaWj84NWC0mQiszuyxoPHL3qy6NjzWyJmQn5-3KAuFZSlGePPJz46GVh3hXSZBen0BcUQdVzyr7S941B6V4x7v4gNuYipiBv7j5sbWURwmtx0jeFOEEuX9b2AfpIo/s1600/bob.jpg"/></a></div> a. Identify the syndrome and write the genotype. <p> b. It occurs in both sexes (male and female). Write the reason. </div>
<div class="answer"> <p>β
<b>Answer</b></p> (a) Downβs syndrome. Genotype is 45A+XX/XY <p> (b) Dwonβs syndrome is not a sex-linked disorder. It is the presence of an additional copy of chromosome number 21 (trisomy of 21). i.e., it is an autosomal problem. </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> 9) Result of a famous experiment is given in the figure. Answer the questions. <div class="separator" style="clear: both;"><a href="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEgxkbzjuaS2h-XIGxoMlmcNtPfcQ4jbgn0UTD3gRj9occSgzRkNcRUOYZVrlM_Ubh2jLskszk0ciaM-jpaHnLRjFhUmf8ymxKL-vAibP01VT5fvwxDdkKIc-5xMI_DNPaPd9_IlV-YFWQUF67qyJiFVl0ZsghEFVPtzyddsL4YOrzvbpKQkZEVdBdoB2Gs/s1600/bob2.png" style="display: block; padding: 1em 0; text-align: center; "><img alt="" border="0" data-original-height="205" data-original-width="500" src="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEgxkbzjuaS2h-XIGxoMlmcNtPfcQ4jbgn0UTD3gRj9occSgzRkNcRUOYZVrlM_Ubh2jLskszk0ciaM-jpaHnLRjFhUmf8ymxKL-vAibP01VT5fvwxDdkKIc-5xMI_DNPaPd9_IlV-YFWQUF67qyJiFVl0ZsghEFVPtzyddsL4YOrzvbpKQkZEVdBdoB2Gs/s1600/bob2.png"/></a></div> a. Identify the experiment. <p> b. Which property of the DNA is proved by this experiment? </div>
<div class="answer"> <p>β
<b>Answer</b></p> a. Meselson-Stahl experiment. <p> b. Semi-conservative model of DNA replication.
</div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> 10) Given below is the diagrammatic representation of first stage of a process in bacteria. <div class="separator" style="clear: both;"><a href="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEj67O5MiXkGHc6CZfeFwPFdZQQvenIh7SzOejImXVoIzL84KDlVvoYjiXqV_bb8NgFnKsElf3dxTHdEVBRwF4zPQTtjgoxhwQQv0zoYlJml9I4vcPxdN0_yDFoAXWZhVvyVIWErwXeDRS4j1CA6J5-i3r0vWomtOi__K7VP_Nk110EWxeBMb_ceuWrvEB0/s1600/bob2.png" style="display: block; padding: 1em 0; text-align: center; "><img alt="" border="0" data-original-height="86" data-original-width="400" src="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEj67O5MiXkGHc6CZfeFwPFdZQQvenIh7SzOejImXVoIzL84KDlVvoYjiXqV_bb8NgFnKsElf3dxTHdEVBRwF4zPQTtjgoxhwQQv0zoYlJml9I4vcPxdN0_yDFoAXWZhVvyVIWErwXeDRS4j1CA6J5-i3r0vWomtOi__K7VP_Nk110EWxeBMb_ceuWrvEB0/s1600/bob2.png"/></a></div> a. Identify the process. <p> b. Name the enzyme which catalyzes this process. <p> c. What are the additional complexities in eukaryotes for this process? </div>
<div class="answer"> <p>β
<b>Answer</b></p> (a) Transcription. <p> (b) <i>DNA-dependent RNA polymerase</i> <p> (c) (i) There are 3 types of <i>RNA polymerases</i>. (ii) The primary transcripts (hnRNA) should be processed to become functional mRNA. </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> 11) (a) Define mutation. <p> (b) What are the different types of mutation? </div>
<div class="answer"> <p>β
<b>Answer</b></p> (a) Mutation the alteration of DNA sequences resulting in changes in the genotype and phenotype of an organism. <p> (b) Point mutation & Frame-shift mutation.
</div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> 12) Observe the inheritance shown in A and B. <div class="separator" style="clear: both;"><a href="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEhPtb2xfLxkEgvBQnVlri2t7KZKA5_yd7AShILncwyAR3roecBSIakE2hgvBGlNiocRdtJEg3IPPTzs9sFGmnIQlvFBQlk2lZz6q6ATxVQOJamL7if77NB0pX7N1cuTqmjSq6Ise8coJbNFxWoxBmyhh_pOtlZiAnmFQ81cltSB3iBA1VkmmYUSArXoRKs/s1600/bob2.png" style="display: block; padding: 1em 0; text-align: center; "><img alt="" border="0" data-original-height="391" data-original-width="478" src="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEhPtb2xfLxkEgvBQnVlri2t7KZKA5_yd7AShILncwyAR3roecBSIakE2hgvBGlNiocRdtJEg3IPPTzs9sFGmnIQlvFBQlk2lZz6q6ATxVQOJamL7if77NB0pX7N1cuTqmjSq6Ise8coJbNFxWoxBmyhh_pOtlZiAnmFQ81cltSB3iBA1VkmmYUSArXoRKs/s1600/bob2.png"/></a></div> a. Name the type of the inheritance shown in A & B. <p> b. What is the difference between the two types of inheritance? </div>
<div class="answer"> <p>β
<b>Answer</b></p> (a) A= Incomplete dominance <p> B= Codominance <p> (b) <b>Incomplete Dominance</b> is an inheritance in which heterozygous offspring shows intermediate character between two parental characteristics. <p> <b>Codominance</b> is the inheritance in which both alleles of a gene are expressed in a hybrid.
</div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> 13) Amniocentesis for sex determination is banned in our country. Is this ban necessary? Comment on use of amniocentesis. </div>
<div class="answer"> <p>β
<b>Answer</b></p> Yes. Because Amniocentesis is misused for sex determination. If the foetus is female, it is followed by MTP. This leads to male-female inequality and injustice to female. <p> Amniocentesis can be used legally to test the presence of genetic disorders, survivability of the foetus etc.
</div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> 14) All copulations lead to fertilisation and pregnancy. Give reason. </div>
<div class="answer"> <p>β
<b>Answer</b></p> Fertilisation can only occur if the ovum and sperms are transported simultaneously to the ampullary region. </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> 15) Observe the diagram provided (Do not copy the picture). <div class="separator" style="clear: both;"><a href="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEj_ZlUC8s-ZebZ3UX_Vjy4TAwfHp9U5mMVpvR4A1NA8jr90SLtUGzIjQQrYgRCYJ3rNuacEO1jkGyevKMln4YQbCgbpl2U7QDWIKUgCMKyzxikCv6zo8YlbBXd45K2Ip4JZXch3r0AlDFB1XwV520PXyVspWP5BaiHmuPfiJ32Lpna53FllZXcxs4duikw/s1600/bob2.png" style="display: block; padding: 1em 0; text-align: center; "><img alt="" border="0" data-original-height="225" data-original-width="400" src="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEj_ZlUC8s-ZebZ3UX_Vjy4TAwfHp9U5mMVpvR4A1NA8jr90SLtUGzIjQQrYgRCYJ3rNuacEO1jkGyevKMln4YQbCgbpl2U7QDWIKUgCMKyzxikCv6zo8YlbBXd45K2Ip4JZXch3r0AlDFB1XwV520PXyVspWP5BaiHmuPfiJ32Lpna53FllZXcxs4duikw/s1600/bob2.png"/></a></div> a. Label A & B. <p> b. Write the name and function of the structure forming inside the ovary after the rupture of Graafian follicle. </div>
<div class="answer"> <p>β
<b>Answer</b></p> (a) A= Primary follicle <p> B= Tertiary follicle. <p> (b) Corpus luteum. It secretes a hormone called progesterone which helps to maintain endometrium. </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> 16) In our state, waste management is a problem. Government promotes and gives subsidy to Biogas plants. Comment the functioning of biogas plants with the help of microbes. </div>
<div class="answer"> <p>β
<b>Answer</b></p> The cattle dung can be used for generation of biogas because it is rich in <i>Methanobacterium</i>. <p> The Biogas plant consists of a concrete tank to collect bio-wastes and slurry of dung. A floating cover is placed over the slurry, which keeps on rising as the biogas is produced. An outlet which is connected to a pipe to supply biogas. Another outlet is used to remove spent slurry.
</div>
<button class="answer-button">View Answer</button>
</div>
<p style="font-size: 18px; font-family: Arial; text-align: left; color: #5c5c5c; background-color: #ebeaec; padding: 10px;"> <b> <i>III. Answer any 3 questions from 17 β 20. Each carries 3 scores. (3 x 3 = 9)</i> </b> </p>
<div class="box">
<div class="question"> 17) (a) Paternity or maternity can be determined by certain scientific methods. What is it? Define. <p> (b) Briefly explain the principles of this technique. <p> (c) Comment on its other applications. </div>
<div class="answer"> <p>β
<b>Answer</b></p> (a) DNA fingerprinting. It is the technique to identify the similarities and differences of the DNA fragments of 2 individuals. Paternity or maternity can be determined by certain scientific methods. <p> (b) DNA fingerprinting is based on variable number tandem repeats (VNTR). It is specific from person to person. <p> (c) <b>Other applications:</b> <p> β’ Used to solve rape, murder etc. <p> β’ For the diagnosis of genetic diseases. <p> β’ To determine phylogenetic status of animals. <p> β’ To determine population and genetic diversities.
</div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> 18) (a) What is ART? <p> (b) Diagnostic report of two couples having infertility problems are given below. Suggest a suitable Assisted Reproductive Technologies (ART) for each problem in expanded form. <p> i. The woman cannot produce ovum. <p> ii. The man has very low sperm count in semen. </div>
<div class="answer"> <p>β
<b>Answer</b></p> (a) Assisted reproductive technologies (ART) are the technologies used to correct the infertility problems. <p> (b) i. Gamete Intra Fallopian Transfer (GIFT). <p> ii. The man has very low sperm count in semen. Artificial insemination (AI) / Intra-uterine insemination (IUI).
</div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> 19) Four groups of organs are given below. Read them carefully and answer the questions: <p> i. Thorns of <i>Bougainvillea</i> and tendrils of <i>Cucurbita</i> <p> ii. Eyes of Octopus and mammals <p> iii. Flippers of Penguin and Dolphin <p> iv. Forelimbs of Cheetah and man <p> a. Categorise the four groups of organs as homologous organs and analogous organs. <p> b. Based on each group of organs differentiate convergent evolution and divergent evolution. </div>
<div class="answer"> <p>β
<b>Answer</b></p> (a) <b>Homologous organs:</b> Thorns of <i>Bougainvillea</i> and tendrils of <i>Cucurbita</i>, Forelimbs of Cheetah and man.<p> <b>Analogous organs:</b> Eyes of Octopus and mammals, Flippers of Penguin and Dolphin. <p> (b) <b>Divergent evolution:</b> It is the evolution by which related species become less similar to survive and adapt in different environmental condition. <p> <b>Convergent evolution:</b> It is the evolution by which unrelated species become more similar to survive and adapt in similar environmental condition.
</div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> 20) Two approaches of conservation of biodiversity are shown as A and B. <div class="separator" style="clear: both;"><a href="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEg0Zmjy-XhOYKVFYPAE59ng3mNA2NLye3r2hwGTaDsrtuFzIxjRQCjal1UHQLdR8gcM82N8O8USB6MIb3dsanHhbAopQozinUxu5RNxAkabPmfPLY0CAWQFUh38tshmg7JrQ9_a3gNGAkUrFddsfr7CCVPnIKoFYMiYKNY13-u4VajSI9to8iQRL_NCGhI/s1600/bob2.png" style="display: block; padding: 1em 0; text-align: center; "><img alt="" border="0" data-original-height="147" data-original-width="420" src="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEg0Zmjy-XhOYKVFYPAE59ng3mNA2NLye3r2hwGTaDsrtuFzIxjRQCjal1UHQLdR8gcM82N8O8USB6MIb3dsanHhbAopQozinUxu5RNxAkabPmfPLY0CAWQFUh38tshmg7JrQ9_a3gNGAkUrFddsfr7CCVPnIKoFYMiYKNY13-u4VajSI9to8iQRL_NCGhI/s1600/bob2.png"/></a></div> a. Identify the type of biodiversity conservation shown in A and B. <p> b. Write the difference between the two types of biodiversity conservation shown in A and B. <p> c. Which of the above approach is more desirable when there is an urgent need to save a species? </div>
<div class="answer"> <p>β
<b>Answer</b></p> (a) A= <i>In situ</i> conservation B= <i>Ex situ</i> conservation. <p> (b) <b><i>In situ</i> conservation:</b> It is the conservation of genetic resources within natural or human-made ecosystems in which they occur. <p> <b><i>Ex situ</i> conservation:</b> It is the conservation of organisms outside their habitats. <p> (c) <i>Ex situ</i> conservation.
</div>
<button class="answer-button">View Answer</button>
</div>
<script>
// Get all the answer buttons
const answerButtons = document.querySelectorAll('.answer-button');
// Add a click event listener to each answer button
answerButtons.forEach(button => {
button.addEventListener('click', () => {
// Get the answer section for this button
const answerSection = button.previousElementSibling;
// Toggle the answer section's visibility
answerSection.classList.toggle('visible');
// Change the button text to "Hide Answer" or "View Answer"
if (answerSection.classList.contains('visible')) {
button.textContent = 'Hide Answer';
button.classList.add('hide-answer');
} else {
button.textContent = 'View Answer';
button.classList.remove('hide-answer');
}
});
});
</script>
<html>
<head>
<style>
.special-paragraph {
margin-bottom: -10px; /* Adjust this value to reduce the space */
color: #333333;
font-family: Arial, sans-serif;
font-size: 23px;
font-weight: bold;
line-height: 1.5;
padding: 7px;
text-align: center;
border-radius: 10px;
}
.green-bg {
background-color: #ddffd9; /* Green background */
}
.blue-bg {
background-color: #b0eaff; /* Blue background */
}
</style>
</head>
<body>
<p class="special-paragraph green-bg">
<a href="https://www.bankofbiology.com/2020/10/hse-1-2-model-qp-online-exam-series.html" style="color: green;"> π Other Question Papers </a>
</p>
<p class="special-paragraph blue-bg">
<a href="https://www.bankofbiology.com/p/question-bank.html" style="color: blue;"> π Exam Special Materials </a>
</p>
</body>
</html>
<div class="blogger-post-footer"><p> Β© copyright 2024 β All rights reserved </p>
<a href=βhttps://www.bankofbiology.comβ>bankofbiology.com</a></div>Abu Raniyahttp://www.blogger.com/profile/14189496606355139812noreply@blogger.com0tag:blogger.com,1999:blog-6823671394482492613.post-86630409709084972412024-03-13T16:27:00.003+05:302024-03-18T12:48:46.300+05:30HSE (+1, +2) Model Question Papers (PDF) and Answers<h1 style="text-align: center; font-size: 26px; font-family: Roboto, sans-serif; color: #207557; line-height: 1.5;">HSE (+1, +2) Model QP & Online Exam Series</h1>
<p style="text-align: left; font-size: 20px; font-family: Arial, sans-serif; color: #333;">There are 10 Sets of Biology Model Question papers (PDF) and answers for Class 11 and 12. You can Download them and pactice. </p>
<style>
.main-navigation, .main-navigation {
font-size: 19px;
font-weight: bold;
font-style: normal;
font-family: Roboto, sans-serif;
}
.main-navigation > ol {
list-style: none;
padding-left: 0;
}
.main-navigation li {
margin-bottom: 10px;
}
.submenu, .submenu {
font-size: 18px;
font-weight: normal;
font-style: normal;
font-family: Arial, sans-serif;
}
/* move the submenu bullets to inner side */
.submenu li:before {
padding-left: 10px;
}
.main-navigation ul {
list-style-type: none;
}
.submenu li {
padding-left: 2px;
text-indent: 15px;
}
ol {
color: #2e6df4; /* set the color of the number */
counter-reset: item; /* reset the counter for the list */
list-style-type: none; /* remove the default list style */
padding-left: 0;
}
ol li:before {
content: counter(item) ". ";
counter-increment: item;
color: #2e6df4; /* set the color of the number */
font-weight: bold; /* make the number bold */
display: inline-block;
width: 1 em; /* set a fixed width for the number */
text-align: left;
margin-right: 0.2em; /* add some space between number and text */
}
</style>
<nav class="main-navigation">
<ol>
<li class="has-submenu">
<a href="#"> HSE (+1) MODEL QUESTION PAPERS (PDF) & ANSWERS </a>
<i class="submenu-toggle fas fa-chevron-down"></i>
<ul class="submenu" style="display: none;">
<li> π <a href="https://www.bankofbiology.com/2024/03/plus-one-biology-model-qp-set1.html" target="_blank">SET 1</a> </li>
<li> π <a href="https://www.bankofbiology.com/2024/03/plus-one-biology-model-qp-set2.html" target="_blank">SET 2</a> </li>
<li> π SET 3 </li>
<li> π SET 4 </li>
<li> π SET 5 </li>
<li> π SET 6 </li>
<li> π SET 7 </li>
<li> π SET 8 </li>
<li> π SET 9 </li>
<li> π SET 10 </li>
</ul>
</li>
<li class="has-submenu">
<a href="#"> HSE (+2) MODEL QUESTION PAPERS (PDF) & ANSWERS </a>
<i class="submenu-toggle fas fa-chevron-down"></i>
<ul class="submenu" style="display: none;">
<li> π <a href="https://www.bankofbiology.com/2024/03/plus-two-model-qp-set1.html" target="_blank">SET 1</a> </li>
<li> π <a href="https://www.bankofbiology.com/2024/03/plus-two-biology-model-qp-set2.html" target="_blank">SET 2</a> </li>
<li> π <a href="https://www.bankofbiology.com/2024/03/plus-two-biology-model-qp-set3.html" target="_blank">SET 3</a> </li>
<li> π <a href="https://www.bankofbiology.com/2024/03/plus-two-biology-model-qp-set4.html" target="_blank">SET 4</a> </li>
<li> π <a href="https://www.bankofbiology.com/2024/03/plus-two-biology-model-qp-set5.html" target="_blank">SET 5</a> </li>
<li> π <a href="https://www.bankofbiology.com/2024/03/plus-two-biology-model-qp-set6.html" target="_blank">SET 6</a> </li>
<li> π <a href="https://www.bankofbiology.com/2024/03/plus-two-biology-model-qp-set7.html" target="_blank">SET 7</a> </li>
<li> π <a href="https://www.bankofbiology.com/2024/03/plus-two-biology-model-qp-set8.html" target="_blank">SET 8</a> </li>
<li> π <a href="https://www.bankofbiology.com/2024/03/plus-two-biology-model-qp-set9.html" target="_blank">SET 9</a> </li>
<li> π <a href="https://www.bankofbiology.com/2024/03/plus-two-biology-model-qp-set10.html" target="_blank">SET 10</a> </li>
</ul>
</li>
</ol>
</nav>
<script src="https://code.jquery.com/jquery-3.6.0.min.js"></script>
<script>
$(document).ready(function() {
$('.has-submenu > a, .submenu-toggle').click(function(e) {
e.preventDefault();
$(this).parent().toggleClass('active');
$(this).siblings('.submenu').slideToggle();
$('.has-submenu').not($(this).parent()).removeClass('active').children('.submenu').slideUp();
});
});
</script>
<div><br /></div>
<div>
<h2 style="color: black; text-align: left;">
<span style="font-family: Oswald;"
><span style="font-size: large;"
><span style="color: #38761d;"
><span>π </span
><a
href="http://www.bankofbiology.com/2012/12/plus-two-zoology-previous-years.html"
target="_blank"
>+2 PREVIOUS YEARS QUESTION PAPERS & ANSWERS</a
></span
></span
></span
>
</h2>
<h2 style="color: black; text-align: left;">
<span style="font-family: Oswald;"
><span style="font-size: large;"
><span style="color: #38761d;"
><span
>π <a
href="https://www.bankofbiology.com/2020/10/plus-one-class-11-biology-previous.html"
target="_blank"
>+1 </a
></span
><a
href="https://www.bankofbiology.com/2020/10/plus-one-class-11-biology-previous.html"
target="_blank"
>PREVIOUS YEARS QUESTION PAPERS & ANSWERS</a
></span
></span
></span
>
</h2>
<h2 style="color: black; text-align: left;">
<span style="font-family: Oswald;"
><span style="font-size: large;"
><span style="color: #38761d;"
><span>π </span
><a
href="https://www.bankofbiology.com/2019/01/chapter-wise-previous-year-questions.html"
target="_blank"
>CHAPTER-WISE QUESTIONS & ANSWERS</a
><span> </span></span
></span
></span
>
</h2>
<h2 style="color: black; text-align: left;">
<span style="font-size: large;"
><span style="color: #38761d; font-family: Oswald;"
><span>π </span
><a
href="https://www.bankofbiology.com/2020/10/hse-1-2-model-qp-online-exam-series.html"
target="_blank"
>HSE (+1, +2) MODEL QP & ONLINE EXAM SERIES</a
><span> </span></span
></span
>
</h2>
<h2 style="color: black; text-align: left;">
<span style="font-size: large;"
><span
><span style="color: #38761d; font-family: Oswald;"
><span>π </span
><a
href="http://www.bankofbiology.com/2018/02/ncert-questions-with-answers-class-xii.html"
target="_blank"
>NCERT QUESTIONS WITH ANSWERS CLASS XII/ PLUS TWO</a
></span
></span
></span
>
</h2>
<h2 style="color: black; text-align: left;">
<span style="font-family: Oswald; font-size: large;"
><span style="color: #38761d;">π </span
><a
href="http://www.bankofbiology.com/2018/02/ncert-questions-with-answers-class-xi.html"
target="_blank"
>NCERT QUESTIONS WITH ANSWERS CLASS XI/ PLUS ONE</a
><span style="color: #38761d;"> </span></span
>
</h2>
</div>
<div class="blogger-post-footer"><p> Β© copyright 2024 β All rights reserved </p>
<a href=βhttps://www.bankofbiology.comβ>bankofbiology.com</a></div>Abu Raniyahttp://www.blogger.com/profile/14189496606355139812noreply@blogger.com0tag:blogger.com,1999:blog-6823671394482492613.post-70219173513072839402024-03-13T10:44:00.090+05:302024-03-16T07:03:49.139+05:30Plus Two Biology (Bot + Zoo) | Practice Model Question Paper PDF with Answer key | SET 9<!DOCTYPE html>
<html>
<head>
<title>Example Webpage</title>
<style>
body {
user-select: none; /* Prevent selection of text */
-moz-user-select: none; /* Firefox */
-webkit-user-select: none; /* Safari and Chrome */
-ms-user-select: none; /* Internet Explorer/Edge */
}
h1 {
user-select: text; /* Allow selection of title */
}
</style>
</head>
<p style="font-size: 25px; font-family: Arial; text-align: center; color: #2068d4; line-height: 1.5;"> <b> π <a href="https://drive.google.com/file/d/1DAsG9g1XjuDOHLmSV4zBFdbP6Eccty_D/view?usp=sharing" target="_blank">Download Biology Question Paper PDF - SET 9</a> </b> </p>
<style>
/* Customize the box style */
.box {
background-color: #ffffff;
border: 1px solid #ffffff;
border-radius: 1px;
padding: 10px;
margin-bottom: 10px;
margin-right: -14px;
margin-left: -14px;
}
/* Customize the question style */
.question {
font-size: 17px;
font-weight: bold;
color: #3D4849;
font-family: Open Sans;
margin-bottom: 6px;
}
/* Customize the answer style */
.answer {
font-size: 18px;
font-weight: normal;
font-family: Roboto;
margin-bottom: 6px;
background-color: #e7ffde;
}
/* Hide the answer by default */
.answer {
display: none;
}
/* Customize the view/hide answer button */
.answer-button {
background-color: #4CAF50;
border: none;
border-radius: 5px;
color: white;
padding: 8px 16px;
text-align: center;
text-decoration: none;
display: inline-block;
font-size: 18px;
margin-bottom: 1px;
cursor: pointer;
}
/* Style the button differently when it changes to "Hide Answer" */
.answer-button.hide-answer {
background-color: #f44336;
}
/* Show the answer when the visible class is added */
.answer.visible {
display: block;
}
.table-text {
display: grid;
grid-template-columns: 50% 50%;
grid-gap: none;
margin-top: 5px;
border-collapse: collapse;
}
.table-text-2 {
display: grid;
grid-template-columns: 33.33% 33.33% 33.33%;
grid-gap: none;
margin-top: 5px;
border-collapse: collapse;
}
.table-text-header,
.table-text-cell {
padding: 5px;
border: 1px solid black;
text-align: left;
}
.table-text-header {
font-weight: bold;
text-align: center;
}
.no-break {
white-space: nowrap;
}
.tab {
text-indent: 40px; /* Adjust the value as per your preference */
}
blockquote {
background: none; /* Remove background color */
border: none; /* Remove border */
margin: 0; /* Remove default margin */
padding: 0 0 0 20px; /* Retain padding on the left side */
}
blockquote:before {
content: none; /* Remove quote marks */
}
</style>
<p style="font-size: 30px; font-family: Arial; text-align: center; color: #0c8a7d; background-color: #a2f5d3; padding: 10px;"> <b> PART A: BOTANY </b></p>
<p style="font-size: 18px; font-family: Arial; text-align: left; color: #5c5c5c; background-color: #ebeaec; padding: 10px;"> <b> <i>I. Answer any 3 questions from 1 β 5. Each carries 1 score. (3 x 1 = 3)</i> </b> </p>
<div class="box">
<div class="question">1) The density of population in a given habitat increase or decrease due to different reasons. Name two factors responsible for increase in population in a given area. </div>
<div class="answer"><p>β
Natality (B) and Immigration (I). </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question">2) The rate of biomass production in an ecosystem is called productivity. They are of 2 types, gross primary productivity and net primary productivity. How these productivities are related? </div>
<div class="answer"><p>β
NPP = GPP β R </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question">3) From the following, select the two having haploid chromosome number. <p> a. Egg b. Endosperm <p> c. Zygote d. Pollen </div>
<div class="answer"><p>β
(a) Egg (d) Pollen </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> 4) Which among the following is a selectable marker in pBR322? <p> a. Ori b. Hind III <p> c. amp<sup>R</sup> d. rop </div>
<div class="answer"> <p>β
(c) amp<sup>R</sup> </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question">5) Give two examples for <i>cry</i> genes. </div>
<div class="answer"><p>β
cryIAc, cryIAb, cryIIAb </div>
<button class="answer-button">View Answer</button>
</div>
<p style="font-size: 18px; font-family: Arial; text-align: left; color: #5c5c5c; background-color: #ebeaec; padding: 10px;"> <b> <i>II. Answer any 9 questions from 6 β 16. Each carries 2 scores. (9 x 2 = 18)</i> </b> </p>
<div class="box">
<div class="question"> 6) A list of different organisms in an ecosystem is given below. Arrange them in 1st, 2nd, 3rd and 4th trophic level. <p> i. Phytoplankton ii. Man <p> iii. Fish iv. Zooplankton </div>
<div class="answer"> <p>β
<b>Answer</b></p> <div class="separator" style="clear: both;"><a href="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEhsaB8Kb6WI5Dv2DwveFBMbmi784Qz43Tse0FQlFxna1UTY7BeSq6H2pHyb_u8Mn3wT3FR12HoBwQw4XEOSfFYo9d0R30tArLCm7I18M4XLHnYITPhzwTAzVsct6uEuaCleS3xXb3xhAMouHjLQ0sFCxCqWncMYSexUTdM4myRyZTGr-UEs56fR6XQJ4lw/s1600/bob2.png" style="display: block; padding: 1em 0; text-align: center; "><img alt="" border="0" data-original-height="288" data-original-width="300" src="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEhsaB8Kb6WI5Dv2DwveFBMbmi784Qz43Tse0FQlFxna1UTY7BeSq6H2pHyb_u8Mn3wT3FR12HoBwQw4XEOSfFYo9d0R30tArLCm7I18M4XLHnYITPhzwTAzVsct6uEuaCleS3xXb3xhAMouHjLQ0sFCxCqWncMYSexUTdM4myRyZTGr-UEs56fR6XQJ4lw/s1600/bob2.png"/></a></div> </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> 7) In many grasses, seeds are formed only after fertilization. There are reports that in some grasses, seeds are formed without fertilization. Explain the phenomenon. </div>
<div class="answer"> <p>β
<b>Answer</b></p> Apomixis. It is the production of seeds without fertilisation. E.g. Some species of <i>Asteraceae</i> and grasses. <p> It is a form of asexual reproduction that mimics sexual reproduction. <p> In some species, diploid egg cell is formed without reduction division and develops into the embryo without fertilisation. </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> 8) What is stratification? Explain with example. </div>
<div class="answer"> <p>β
<b>Answer</b></p> Vertical distribution of different species occupying different levels is called stratification. For example, trees occupy top vertical strata or layer of a forest, shrubs the second and herbs and grasses occupy the bottom layers. </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> 9) (a) Identify the picture A and B. <div class="separator" style="clear: both;"><a href="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEiTadhzMvCOiD5yebPllUDHQ6VvV4F2F0EzoOi1elz15l-CjWZaKBqXsYgmU53ugUiaH8uPXALnQP1NnKN6xySE_xyN4Ba55ubEARLwFL62ehVez3Qdv4kAJQCLqzr_lNHsNXSGC91sq1wt7fO80i5pz5df5hAnJko6MHV7GNRCh84BW6vGvvXaoi86dVo/s1600/bob.jpg" style="display: block; padding: 1em 0; text-align: center; "><img alt="" border="0" data-original-height="652" data-original-width="606" src="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEiTadhzMvCOiD5yebPllUDHQ6VvV4F2F0EzoOi1elz15l-CjWZaKBqXsYgmU53ugUiaH8uPXALnQP1NnKN6xySE_xyN4Ba55ubEARLwFL62ehVez3Qdv4kAJQCLqzr_lNHsNXSGC91sq1wt7fO80i5pz5df5hAnJko6MHV7GNRCh84BW6vGvvXaoi86dVo/s1600/bob.jpg"/></a></div> (b) What is meant by the terms syncarpous and apocarpous? </div>
<div class="answer"> <p>β
<b>Answer</b></p> (a) A= Multicarpellary, syncarpous pistil of <i>Papaver</i> <p> B= A multicarpellary, apocarpous gynoecium of <i>Michelia</i>. <p> (b) <b>Syncarpous:</b> This is a condition in which the pistils of the gynoecium are fused together. <p> <b>Apocarpous:</b> This is a condition in which the pistils of the gynoecium are free. </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> 10) Imagine you are appointed as biotechnologist in a National Institute. What are the basic steps to be designed to produce a genetically modified organism? (<i>Hint: 3 points</i>) </div>
<div class="answer"> <p>β
<b>Answer</b></p> <b>Basic steps in genetically modifying an organism:</b> <p> <blockquote>β’ Identification of DNA with desirable genes. <p> β’ Introduction of the identified DNA into the host using a vector DNA. <p> β’ Maintenance of introduced DNA in the host and transfer of the DNA to its progeny.</blockquote> </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> 11) (a) In a pond, there were 30 lotus plants last year and through reproduction 14 new plants are added. Calculate birth rate. <p> (b) Besides birth rate, mention any two attributes of a population. </div>
<div class="answer"> <p>β
<b>Answer</b></p> (a) Birth rate= Number of new plants/Initial number of plants. <p> = 14/30 = 0.466 offspring per lotus per year. <p> (b) Death rate, Sex ratio. </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> 12) <i>Alpha-I antitrypsin</i> and <i>alpha-lactalbumin</i> are two biological products produced from transgenic animals. Write the uses of these two products. </div>
<div class="answer"> <p>β
<b>Answer</b></p> <b>Use of Alpha-I antitrypsin:</b> To treat emphysema. <p> <b>Use of alpha-lactalbumin:</b> Nutritionally more balanced product for human babies than natural cow-milk. </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> 13) Use of a thermostable <i>DNA polymerase</i> from the bacterium, <i>Thermus aquaticus</i>, made it possible to generate billion copies of DNA in a very short time using a process. <p> a. Name the process. <p> b. Name the three important steps involved in this process. </div>
<div class="answer"> <p>β
<b>Answer</b></p> (a) Polymerase Chain Reaction (PCR). <p> (b) Denaturation, Annealing & Extension </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> 14) Parasitism is a type of interspecific interaction where one (parasite) is benefitted and the other (host) is harmed. Explain two types of parasites with examples. </div>
<div class="answer"> <p>β
<b>Answer</b></p> <b>1. Ectoparasites:</b> Parasites that feed on the external surface of host. E.g. Lice on humans, <i>Cuscuta</i> plant on hedge plants <p> <b>2. Endoparasites:</b> Parasites that live inside the host body at different sites (liver, kidney, lungs, RBC etc). e.g., <i>Ascaris</i>. </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> 15) Name the following: <p> a. A nematode that infects the roots of tobacco plants. <p> b. A cellular defense mechanism in all eukaryotes that was used as a novel strategy to prevent this infestation. <p> c. A vector used to introduce nematode-specific genes into the host plant. <p> d. Mobile genetic elements used as a source of complementary RNA for RNA<i>i</i>. </div>
<div class="answer"> <p>β
<b>Answer</b></p> (a) <i>Meloidegyne incognitia</i> <p> (b) RNA interference (RNAi) <p> (c) <i>Agrobacterium</i> <p> (d) Transposons </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> 16) Analyze the given graphical representation. <div class="separator" style="clear: both;"><a href="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEiS2FrfQZLr-oHHQMfF9OosyyM0TeZ92ZChlEnFkbFNXB-_Dv4pKhyZRf7sqNeyq9Q44eTuoVmtrN_Z0o_FHkqoJYScQC5COZOIV5GTWx52_itmOBjvBjYJ_pKSs7zTaayIUb7GaFI8PJHo-hTvHP6Geras400cub626gRsDl6yltO-QMIvQjIwtGg7E_E/s1600/bob.jpg" style="display: block; padding: 1em 0; text-align: center; "><img alt="" border="0" data-original-height="334" data-original-width="452" src="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEiS2FrfQZLr-oHHQMfF9OosyyM0TeZ92ZChlEnFkbFNXB-_Dv4pKhyZRf7sqNeyq9Q44eTuoVmtrN_Z0o_FHkqoJYScQC5COZOIV5GTWx52_itmOBjvBjYJ_pKSs7zTaayIUb7GaFI8PJHo-hTvHP6Geras400cub626gRsDl6yltO-QMIvQjIwtGg7E_E/s1600/bob.jpg"/></a></div> a. Identify the curves C<sub>1</sub> and C<sub>2</sub>. <p> b. Write down the equations E<sub>1</sub> and E<sub>2</sub>. </div>
<div class="answer"> <p>β
<b>Answer</b></p> (a) C<sub>1</sub>= Exponential (Geometric) growth curve. <p> C<sub>2</sub>= Logistic (Sigmoid) growth curve. <p> (b) Equation E<sub>1</sub> is <div class="separator" style="clear: both;"><a href="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEgC_hDDbobbamxLje6moJixdfWBUaGJ3eehOFRJeYnayCYeHTEE0K4f-R9ZplojMIq2AIv1U8hRlmyZQ2IWdCJD0Fk_X2pLPFnT_YyTmKccxKN6dLZ7ZWhEKqOY8jnODLK-3G0Jlvkteviyt_z_cwcPJAG3kTT7FILdwLOoGwYb3vnj7hQrspo1xotSSVk/s1600/bob2.png" style="display: block; padding: 0; text-align: left; "> <img alt="" border="0" data-original-height="47" data-original-width="83" src="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEgC_hDDbobbamxLje6moJixdfWBUaGJ3eehOFRJeYnayCYeHTEE0K4f-R9ZplojMIq2AIv1U8hRlmyZQ2IWdCJD0Fk_X2pLPFnT_YyTmKccxKN6dLZ7ZWhEKqOY8jnODLK-3G0Jlvkteviyt_z_cwcPJAG3kTT7FILdwLOoGwYb3vnj7hQrspo1xotSSVk/s1600/bob2.png"/></a></div> <p> Equation E<sub>2</sub> is <div class="separator" style="clear: both;"><a href="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEg2xY4sY0qIdQweYJ5gw4oN8eeA5-tJvStvSnhRpbndjnIuNQ9oulUE_2P_w19Wdi2tYiWxKQsyauyQUgApRp99F8LdIYKhu-9jLs5LirMjWjjFNnjwEUXghRFk1qyUhF5YtG-mG5J0heqvNI9icnYMX1CgNY6VlvzOfw0Q1gCxqTkV6OCO-5SCiID-e6I/s1600/bob2.png" style="display: block; padding: 0; text-align: left; "> <img alt="" border="0" data-original-height="47" data-original-width="150" src="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEg2xY4sY0qIdQweYJ5gw4oN8eeA5-tJvStvSnhRpbndjnIuNQ9oulUE_2P_w19Wdi2tYiWxKQsyauyQUgApRp99F8LdIYKhu-9jLs5LirMjWjjFNnjwEUXghRFk1qyUhF5YtG-mG5J0heqvNI9icnYMX1CgNY6VlvzOfw0Q1gCxqTkV6OCO-5SCiID-e6I/s1600/bob2.png"/></a></div> </div>
<button class="answer-button">View Answer</button>
</div>
<p style="font-size: 18px; font-family: Arial; text-align: left; color: #5c5c5c; background-color: #ebeaec; padding: 10px;"> <b> <i>III. Answer any 3 questions from 17 β 20. Each carries 3 scores. (3 x 3 = 9)</i> </b> </p>
<div class="box">
<div class="question"> 17) The discovery of <i>Restriction Endonuclease</i> is considered as a milestone in the history of genetic engineering. <p> <blockquote>a. Which is the first discovered <i>restriction endonuclease</i>? <p> b. What are the criteria for naming of <i>restriction endonuclease</i>?</blockquote> </div>
<div class="answer"> <p>β
<b>Answer</b></p> (a) Hind II. <p> (b) <b>First capital letter:</b> Genus name. <p> <b>Second two letters:</b> Species name. <p> <b>Fourth letter:</b> Strain of bacterium from which the enzyme is isolated. <p> <b>Roman number:</b> Order of isolation of enzyme. </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> 18) In plants, the developmental stages of male gametes consist of microsporogenesis and male gametophyte. Arrange the following terms in their correct developmental sequence. <center> <p> Pollen grain <br> Sporogenous tissue <br> Anther <br> Microspore tetrad <br> Pollen mother cell <br> Male gamete </center> </div>
<div class="answer"> <p>β
<b>Answer</b></p> <center> Anther <br> β <br> Sporogenous Tissue <br> β <br> Pollen Mother Cell <br> β <br> Microspore Tetrad <br> β <br> Pollen Grain <br> β <br> Male Gamete </center> </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> 19) Although biotechnology offers many benefits to humans, it also raises some ethical issues. <p> <blockquote>a. Explain any two ethical issues regarding application of biotechnology. <p> b. State any two steps taken by the Government of India to overcome such problems.</blockquote> </div>
<div class="answer"> <p>β
<b>Answer</b></p> (a) Ethical issues regarding application of biotechnology: <p> <b>i. Problem of unpredictable results:</b> Genetic modification may cause unpredictable results. <p> <b>ii. Biopiracy: </b>It is the use of bio-resources by multinational companies and other organizations without proper authorization from the countries and people concerned. <p> <b>(b) Steps taken by the Government of India:</b> <p> β’ <b>To solve the problem of unpredictable results: </b>Organizations like GEAC (Genetic Engineering Approval Committee) to make decisions about the validity of GM research and the safety of GM-organisms for public services. <p> β’ <b>To solve the problem of Biopiracy:</b> Indian Parliament has cleared the second amendment of the Indian Patents Bill that has considered patent terms emergency provisions and research and development initiative. </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> 20) (a) What are decomposers? Give two examples. <p> (b) Suggest another name for decomposers. <p> (c) Briefly explain action of decomposers on their food. </div>
<div class="answer"> <p>β
<b>Answer</b></p> (a) Decomposers are heterotrophic organisms that meet their energy and nutrient requirements by degrading dead organic matter or detritus. E.g., fungi and bacteria. <p> (b) These are also known as saprotrophs. <p> (c) Decomposers secrete digestive enzymes that breakdown dead and waste materials into simple, inorganic materials, which are subsequently absorbed by them. </div>
<button class="answer-button">View Answer</button>
</div>
<p style="font-size: 30px; font-family: Arial; text-align: center; color: #993d77; background-color: #ffe0f4; padding: 10px;"> <b> PART B: ZOOLOGY </b></p>
<p style="font-size: 18px; font-family: Arial; text-align: left; color: #5c5c5c; background-color: #ebeaec; padding: 10px;"> <b> <i>I. Answer any 3 questions from 1 β 5. Each carries 1 score. (3 x 1 = 3)</i> </b> </p>
<div class="box">
<div class="question">1) Which of the following do not have similar sex chromosomes (Homogametic)? <p> (a) Human female (b) <i>Drosophila</i> female <p> (c) Bird female (d) Bird male </div>
<div class="answer"><p>β
(c) Bird female </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question">2) Which among the following does not belong to Assisted Reproductive Technology? <p> (a) ICSI (b) IUD <p> (c) IUT (d) GIFT </div>
<div class="answer"><p>β
(b) IUD </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question">3) Note the relationship between the terms of first pair and fill up the fourth place. <p> Prokaryotes: Polycistronic structural gene <p> Eukaryotes: β¦β¦β¦β¦β¦β¦. </div>
<div class="answer"><p>β
Monocistronic structural gene </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> 4) Which of the following sets of gases were used in Millerβs experiment? <p> (a) CH<sub>4</sub>, NO<sub>2</sub>, H<sub>2</sub>O, CO<sub>2</sub> <p> (b) NH<sub>3</sub>, NO<sub>2</sub>, H<sub>2</sub>O, H<sub>2</sub> <p> (c) H<sub>2</sub>, CH<sub>4</sub>, NH<sub>3</sub>, H<sub>2</sub>O <p> (d) H<sub>2</sub>O, N<sub>2</sub>, CH<sub>4</sub>, H<sub>2</sub> </div>
<div class="answer"> <p>β
(c) H<sub>2</sub>, CH<sub>4</sub>, NH<sub>3</sub>, H<sub>2</sub>O </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question">5) Diagram of mammalian sperm is given. Label the marked parts. <div class="separator" style="clear: both;"><a href="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEgPnqmUdhkjRDmUF0EZBg9EEuEpT03AfLsW6C5cI-UoHYjHyZWecbSXojZ_jnSf9n30Tvzq8Jyr_sSlzuArkQJ6iAxhsun7fUGTd21MMLbOVguMgd4XPd3Fwo0w3yaAf_im9Fkxgb2B8WSIoTMtfz6Ce12lYsGlJIi4yAgYyH8inEDoSWb-IApNSdCkFUw/s1600/bob.jpg" style="display: block; padding: 1em 0; text-align: center; "><img alt="" border="0" data-original-height="389" data-original-width="147" src="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEgPnqmUdhkjRDmUF0EZBg9EEuEpT03AfLsW6C5cI-UoHYjHyZWecbSXojZ_jnSf9n30Tvzq8Jyr_sSlzuArkQJ6iAxhsun7fUGTd21MMLbOVguMgd4XPd3Fwo0w3yaAf_im9Fkxgb2B8WSIoTMtfz6Ce12lYsGlJIi4yAgYyH8inEDoSWb-IApNSdCkFUw/s1600/bob.jpg"/></a></div> </div>
<div class="answer"><p>β
A= Acrosome B= Nucleus </div>
<button class="answer-button">View Answer</button>
</div>
<p style="font-size: 18px; font-family: Arial; text-align: left; color: #5c5c5c; background-color: #ebeaec; padding: 10px;"> <b> <i>II. Answer any 9 questions from 6 β 16. Each carries 2 scores. (9 x 2 = 18)</i> </b> </p>
<div class="box">
<div class="question"> 6) Symptoms of some diseases are given below. Identify the diseases. <p> a. Chill and high fever recurring every 3-4 days. <p> b. Internal bleeding, muscular pain, blockage of intestinal passage. <p> c. Chronic inflammation of the limbs, deformity of limbs and genital organs. <p> d. Dry, scaly lesions on skin, nails, scalp etc. Intense itching. </div>
<div class="answer"> <p>β
<b>Answer</b></p> (a) Malaria (b) Ascariasis <p> (c) Filariasis (d) Ringworm </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> 7) One of your neighbors is suffering from itching, fluid discharge, slight pain and swelling in genital region. <p> a. What do you think the disease he is suffering from? <p> b. What measures are to be taken to prevent such disease? </div>
<div class="answer"> <p>β
<b>Answer</b></p> (a) Sexually Transmitted Infections (STI). <p> (b) Prevention: <p> <blockquote>β’ Avoid sex with unknown partners/multiple partners. <p> β’ Always use condoms during coitus. <p> β’ In case of doubt, consult a qualified doctor for early detection and get complete treatment.</blockquote>
</div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> 8) Distinguish between homologous and analogous organ with one example for each. </div>
<div class="answer"> <p>β
<b>Answer</b></p> Homologous organs are the organs having fundamentally similar structure and origin but different functions. E.g., Human hand, Whaleβs flippers, Batβs wing & Cheetahβs foot. <p> Analogous organs are the organs having similar function but different structure & origin. E.g. Wings of butterfly and wings of birds.
</div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> 9) (a) Mention any two desirable features of a better contraceptive method. <p> (b) Write any two advantages of <i>Saheli</i> over conventional contraceptive pills. </div>
<div class="answer"> <p>β
<b>Answer</b></p> (a) User-friendly, easily available, effective and reversible. No or least side-effects. <p> (b) <i>Saheli</i> is a βonce a weekβ pill with very few side effects and high contraceptive value.
</div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> 10) Briefly explain the steps of processing of hnRNA in eukaryotes to form mRNA. </div>
<div class="answer"> <p>β
<b>Answer</b></p> <b>Steps of processing of hnRNA:</b> <p> <blockquote> <b>a. Splicing:</b> From hnRNA, introns are removed (by the spliceosome) and exons are spliced (joined) together. <p> <b>b. Capping:</b> Here, a nucleotide methyl guanosine triphosphate (cap) is added to the 5β end of hnRNA. <p> <b>c. Tailing (Polyadenylation):</b> Here, adenylate residues (200-300) are added at 3β-end. </blockquote>
</div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> 11) βGopalan argues that if father is of βAβ blood group, mother is of βBβ blood group. Their children can only be βAβ group, βBβ group or βABβ group.β <p> a. Do you agree with Gopalanβs argument? <p> b. Give reason for your answer. </div>
<div class="answer"> <p>β
<b>Answer</b></p> (a) No. I do not agree. <p> (b) If parents have heterozygous genotypes of blood group, the children may have O group. <div class="separator" style="clear: both;"><a href="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEhtxK5AOID-OYK1q6LZLOzLq4BB7IKv6jV8py2HGlfGVjdpYmgZqNXsBJVNJ9AAwmq4oNTS11LrXl1pug2TJRdAMEbyFqukvQx08sbgF-CyaEbdi91RPSu-T7ddKhy5O2BDpIxyY-LRGfV2Agzk0JWfymg9uHcyaNlHUsBvr7Kw6b6fgh0VBPCUwrRlxZI/s1600/bob2.png" style="display: block; padding: 0; text-align: center; "><img alt="" border="0" data-original-height="232" data-original-width="400" src="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEhtxK5AOID-OYK1q6LZLOzLq4BB7IKv6jV8py2HGlfGVjdpYmgZqNXsBJVNJ9AAwmq4oNTS11LrXl1pug2TJRdAMEbyFqukvQx08sbgF-CyaEbdi91RPSu-T7ddKhy5O2BDpIxyY-LRGfV2Agzk0JWfymg9uHcyaNlHUsBvr7Kw6b6fgh0VBPCUwrRlxZI/s1600/bob2.png"/></a></div>
</div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> 12) a) Complete the flowchart of chromosomal disorders by filling the blank boxes (A and B). <div class="separator" style="clear: both;"><a href="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEik5tEOPsvcMZbBiABbhJxMSZ_j0XfSjT-kWrJ368LZ8wBLS7-IDSWSQOcFGQLqOdPRcbXkuycWLpPDJg7EZuScqcWEM8IZe57bK1kpK6JRMxqP-tniSdtdFwnj8TMr2ckreR9rvNghFj_I2qwrAuPegauKui9g2OdTPQktathZGuYRrX25R6Xf8yYhp0Q/s1600/bob2.png" style="display: block; padding: 1em 0; text-align: center; "><img alt="" border="0" data-original-height="238" data-original-width="400" src="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEik5tEOPsvcMZbBiABbhJxMSZ_j0XfSjT-kWrJ368LZ8wBLS7-IDSWSQOcFGQLqOdPRcbXkuycWLpPDJg7EZuScqcWEM8IZe57bK1kpK6JRMxqP-tniSdtdFwnj8TMr2ckreR9rvNghFj_I2qwrAuPegauKui9g2OdTPQktathZGuYRrX25R6Xf8yYhp0Q/s1600/bob2.png"/></a></div> b) What is aneuploidy? </div>
<div class="answer"> <p>β
<b>Answer</b></p> a) A= Monosomy of sex chromosome <p> B= Klinefelterβs syndrome <p> b) Aneuploidy is the gain or loss of chromosomes due to failure of segregation of chromatids during cell division. </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> 13) Read carefully the sequence of codons in the mRNA unit and answer the questions. <div class="separator" style="clear: both;"><a href="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEiJyWjywSbCpcWGBhbKZKX8OnNcEPi6SU-pu7uU9al62XJYZ73gPaOi8P_03FcSXmlZu6w09Q_sd1RVVcDUKjynqG-q3qhIc3o7F9z1dh8YNcsmLCrK_biZyAxNrcac7rhNCwJ8_QCcC-nb5tp8DlPZ_EDYBq1rPYSZm24WNkm2S2klxETVLJYTMbQJ7P4/s1600/bob.jpg" style="display: block; padding: 1em 0; text-align: center; "><img alt="" border="0" data-original-height="92" data-original-width="635" src="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEiJyWjywSbCpcWGBhbKZKX8OnNcEPi6SU-pu7uU9al62XJYZ73gPaOi8P_03FcSXmlZu6w09Q_sd1RVVcDUKjynqG-q3qhIc3o7F9z1dh8YNcsmLCrK_biZyAxNrcac7rhNCwJ8_QCcC-nb5tp8DlPZ_EDYBq1rPYSZm24WNkm2S2klxETVLJYTMbQJ7P4/s1600/bob.jpg"/></a></div> a. What change is needed in the first codon to start the translation process? <p> b. If translation starts by that change, till which codon it can continues? Why? </div>
<div class="answer"> <p>β
<b>Answer</b></p> (a) AUA should be changed to AUG. <p> (b) Till 5th codon (UUU). After that there is a stop codon (UGA) which terminates translation.
</div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> 14) BOD of some water samples are given below: <p> A. Sample 1 - 200 mg/L <p> B. Sample 2 - 80 mg/L <p> C. Sample 3 - 300 mg/L <p> D. Sample 4 - 25 mg/L <p> a. Which of the above water sample is most polluted? <p> b. What is meant by flocs? What is its role in sewage treatment? </div>
<div class="answer"> <p>β
<b>Answer</b></p> (a) Sample 3. As a higher BOD indicates a greater degree of pollution. <p> (b) Flocs are clumps of bacteria and fungal filaments that come together during the sewage treatment. <p> In the treatment process, flocs help in removing organic wastes from the water. Thus water is cleared. </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> 15) Observe the diagram and answer the questions: <div class="separator" style="clear: both;"><a href="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEgGdenF_GhuJi9ca6H7QC1r8HKZF0tjF2OWdeKkmc29Q-SDN8rj5rayLQq0Pk4rcZ4q-L8u4VWvv1vHD75AWHjfj_wrwv9IhR3Qvdnatu0EosDioHqCQB2fFJ9JeujyJpLFlRoslcKkAeiM6xDY0yZIvNCEzdi0WVtIKQJOQy20-6sYWEGDxeZZ0sNTd0o/s1600/bob.jpg" style="display: block; padding: 1em 0; text-align: center; "><img alt="" border="0" data-original-height="298" data-original-width="454" src="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEgGdenF_GhuJi9ca6H7QC1r8HKZF0tjF2OWdeKkmc29Q-SDN8rj5rayLQq0Pk4rcZ4q-L8u4VWvv1vHD75AWHjfj_wrwv9IhR3Qvdnatu0EosDioHqCQB2fFJ9JeujyJpLFlRoslcKkAeiM6xDY0yZIvNCEzdi0WVtIKQJOQy20-6sYWEGDxeZZ0sNTd0o/s1600/bob.jpg"/></a></div> a. Identify the process shown in the figure and define it. <p> b. Identify the structure B. Write any one function of it in the process shown in the diagram. </div>
<div class="answer"> <p>β
<b>Answer</b></p> (a) The process is Translation. It is the process of polymerization of amino acids to form a polypeptide (protein) based on the sequence of codons in mRNA. <p> (b) B is the subunits of ribosome. It acts as the site of translation. </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> 16) Match the following: <div class="separator" style="clear: both;"><a href="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEifaaY5y05ORY-Q_vr5sXE1STAcGWl83OKuJSzMJf9TRZDqooKdvMtBIf7auIFfuKHSdb80k9PgVTDiWYajKz_hDvzj_-JNpyhRrPu-nN_giykwvoluGEaIhhcomuU5u7VPKVYAFBVt55OGT8kQLlLYR-w6goSRr5Di147w0rqI2cHyPxq6dR3bPdFax60/s1600/bob.jpg" style="display: block; padding: 1em 0; text-align: center; "><img alt="" border="0" data-original-height="238" data-original-width="655" src="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEifaaY5y05ORY-Q_vr5sXE1STAcGWl83OKuJSzMJf9TRZDqooKdvMtBIf7auIFfuKHSdb80k9PgVTDiWYajKz_hDvzj_-JNpyhRrPu-nN_giykwvoluGEaIhhcomuU5u7VPKVYAFBVt55OGT8kQLlLYR-w6goSRr5Di147w0rqI2cHyPxq6dR3bPdFax60/s1600/bob.jpg"/></a></div> </div>
<div class="answer"> <p>β
<b>Answer</b></p> <div class="separator" style="clear: both;"><a href="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEh5tE2EeUrzh4WRX6jdAa6e5jtkUdpZRY9p2jDJI8fhESGXI95TSt0KsjkLMA_i3fG3FQm2mptxwgKalLGOLwjJDWoEn6YZQh7oIt31is4twZhIRigOLx__MoikK2FN-XaxIsD2fjre-uETstE3MR_oqAg9ObgewSy6nI63ks4U_QPUh_hh1XSq8oa9sYE/s1600/bob2.png" style="display: block; padding: 0; text-align: center; "><img alt="" border="0" data-original-height="167" data-original-width="450" src="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEh5tE2EeUrzh4WRX6jdAa6e5jtkUdpZRY9p2jDJI8fhESGXI95TSt0KsjkLMA_i3fG3FQm2mptxwgKalLGOLwjJDWoEn6YZQh7oIt31is4twZhIRigOLx__MoikK2FN-XaxIsD2fjre-uETstE3MR_oqAg9ObgewSy6nI63ks4U_QPUh_hh1XSq8oa9sYE/s1600/bob2.png"/></a></div> </div>
<button class="answer-button">View Answer</button>
</div>
<p style="font-size: 18px; font-family: Arial; text-align: left; color: #5c5c5c; background-color: #ebeaec; padding: 10px;"> <b> <i>III. Answer any 3 questions from 17 β 20. Each carries 3 scores. (3 x 3 = 9)</i> </b> </p>
<div class="box">
<div class="question"> 17) βNature provides all for the need of man but not for his greed.β <p> a. Do you agree with this statement? Justify your answer. <p> b. There are 3 categories of reasons for conservation of biodiversity. Mention them. </div>
<div class="answer"> <p>β
<b>Answer</b></p> (a) Yes, I agree. <p> Nature has enough resources to fulfill everyoneβs needs if used wisely and sustainably. However, human activities such as habitat loss and fragmentation, overexploitation etc. lead to depletion of these resources, causing harm to the environment and future generations. <p> (b) Narrowly utilitarian arguments, Broadly utilitarian arguments and Ethical arguments.
</div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> 18) Observe the diagram, and answer the questions: <div class="separator" style="clear: both;"><a href="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEjLw3AtktnF9vjy865QDsnPMC3Cm9sw816BiyN0Ee2eOsy-MZf4-QoAvJMdkbuPgk_5jOS0B4eJlgrT792h3JytNPZJ4PQmeJVJ3SP56Li1K4Ro9nUAxLsaB_jHOYAgLp9isL7XmDxIJPrWSOMWtwvWu0Aa4xnnqa2zOhtOqGhHWx56dk5OEznD9tGY0sk/s1600/bob.jpg" style="display: block; padding: 1em 0; text-align: center; "><img alt="" border="0" data-original-height="337" data-original-width="347" src="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEjLw3AtktnF9vjy865QDsnPMC3Cm9sw816BiyN0Ee2eOsy-MZf4-QoAvJMdkbuPgk_5jOS0B4eJlgrT792h3JytNPZJ4PQmeJVJ3SP56Li1K4Ro9nUAxLsaB_jHOYAgLp9isL7XmDxIJPrWSOMWtwvWu0Aa4xnnqa2zOhtOqGhHWx56dk5OEznD9tGY0sk/s1600/bob.jpg"/></a></div> a. Identify A and B. <p> b. What is the function of C? <p> c. In which of the marked part reduction division takes place? What is the significance of it? </div>
<div class="answer"> <p>β
<b>Answer</b></p> (a) A= Spermatozoa B= Spermatogonium <p> (b) C (Sertoli cell) Sertoli cells provide nutrition to the germ cells. <p> (c) D (Primary spermatocyte). <p> <b>Significance:</b> It leads to formation of two equal, haploid cells called secondary spermatocytes, which have only 23 chromosomes each. </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> 19) βPrediction of the sequence of amino acids from the nucleotide sequence in mRNA is very easy, but the exact prediction of the nucleotide sequence in mRNA from the sequence of amino acids coded by mRNA is difficult.β <p> a. Which properties of the genetic code is the reason for above condition? Explain. <p> b. AUG has dual functions. What are they? </div>
<div class="answer"> <p>β
<b>Answer</b></p> (a) (i) An amino acid is coded by more than one codon (except AUG for methionine & UGG for tryptophan). Such codons are called degenerate codons. <p> <blockquote>(ii) Genetic code is unambiguous and specific. i.e., one codon specifies only one amino acid.</blockquote> <p> (b) (i) AUG codes for Methionine. <p> <blockquote>(ii) It also acts as initiator codon.</blockquote> </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> 20) Prepare a pamphlet for an awareness programme in your school about the measures to prevent and control alcohol and drug abuse in adolescents. </div>
<div class="answer"> <p>β
<b>Answer</b></p> Pamphlet: <p> <center><b>Prevent and Control Alcohol and Drug Abuse in Adolescents</b></center> <p> Alcohol and drug abuse can lead to serious health issues, poor academic performance, and strained relationships. <p> <b>Prevention and control</b> <p> β’ Avoid undue peer pressure. <p> β’ Education and counselling. <p> β’ Seeking help from parents and peers. <p> β’ Looking for danger signs. <p> β’ Seeking professional and medical help. <p> βͺοΈ Psychologists & psychiatrists. <p> βͺοΈ De-addiction & rehabilitation programs. </div>
<button class="answer-button">View Answer</button>
</div>
<script>
// Get all the answer buttons
const answerButtons = document.querySelectorAll('.answer-button');
// Add a click event listener to each answer button
answerButtons.forEach(button => {
button.addEventListener('click', () => {
// Get the answer section for this button
const answerSection = button.previousElementSibling;
// Toggle the answer section's visibility
answerSection.classList.toggle('visible');
// Change the button text to "Hide Answer" or "View Answer"
if (answerSection.classList.contains('visible')) {
button.textContent = 'Hide Answer';
button.classList.add('hide-answer');
} else {
button.textContent = 'View Answer';
button.classList.remove('hide-answer');
}
});
});
</script>
<html>
<head>
<style>
.special-paragraph {
margin-bottom: -10px; /* Adjust this value to reduce the space */
color: #333333;
font-family: Arial, sans-serif;
font-size: 23px;
font-weight: bold;
line-height: 1.5;
padding: 7px;
text-align: center;
border-radius: 10px;
}
.green-bg {
background-color: #ddffd9; /* Green background */
}
.blue-bg {
background-color: #b0eaff; /* Blue background */
}
</style>
</head>
<body>
<p class="special-paragraph green-bg">
<a href="https://www.bankofbiology.com/2020/10/hse-1-2-model-qp-online-exam-series.html" style="color: green;"> π Other Question Papers </a>
</p>
<p class="special-paragraph blue-bg">
<a href="https://www.bankofbiology.com/p/question-bank.html" style="color: blue;"> π Exam Special Materials </a>
</p>
</body>
</html>
<div class="blogger-post-footer"><p> Β© copyright 2024 β All rights reserved </p>
<a href=βhttps://www.bankofbiology.comβ>bankofbiology.com</a></div>Abu Raniyahttp://www.blogger.com/profile/14189496606355139812noreply@blogger.com0tag:blogger.com,1999:blog-6823671394482492613.post-66539996599634779212024-03-11T16:50:00.036+05:302024-03-11T17:39:20.737+05:30Plus Two Biology (Bot + Zoo) | Practice Model Question Paper PDF with Answer key | SET 8<!DOCTYPE html>
<html>
<head>
<title>Example Webpage</title>
<style>
body {
user-select: none; /* Prevent selection of text */
-moz-user-select: none; /* Firefox */
-webkit-user-select: none; /* Safari and Chrome */
-ms-user-select: none; /* Internet Explorer/Edge */
}
h1 {
user-select: text; /* Allow selection of title */
}
</style>
</head>
<p style="font-size: 25px; font-family: Arial; text-align: center; color: #2068d4; line-height: 1.5;"> <b> π <a href="https://drive.google.com/file/d/1DA47JfaCjeD5WhP8Tnu2IvFHtLYZVuO-/view?usp=drive_link" target="_blank">Download Biology Question Paper PDF - SET 8</a> </b> </p>
<p style="font-size: 30px; font-family: Arial; text-align: center; color: #0c8a7d; background-color: #a2f5d3; padding: 10px;"> <b> PART A: BOTANY </b></p>
<style>
/* Customize the box style */
.box {
background-color: #ffffff;
border: 1px solid #ffffff;
border-radius: 1px;
padding: 10px;
margin-bottom: 10px;
margin-right: -14px;
margin-left: -14px;
}
/* Customize the question style */
.question {
font-size: 17px;
font-weight: bold;
color: #3D4849;
font-family: Open Sans;
margin-bottom: 8px;
}
/* Customize the answer style */
.answer {
font-size: 18px;
font-weight: normal;
font-family: Roboto;
margin-bottom: 8px;
background-color: #e7ffde;
}
/* Hide the answer by default */
.answer {
display: none;
}
/* Customize the view/hide answer button */
.answer-button {
background-color: #4CAF50;
border: none;
border-radius: 5px;
color: white;
padding: 8px 16px;
text-align: center;
text-decoration: none;
display: inline-block;
font-size: 18px;
margin-bottom: 1px;
cursor: pointer;
}
/* Style the button differently when it changes to "Hide Answer" */
.answer-button.hide-answer {
background-color: #f44336;
}
/* Show the answer when the visible class is added */
.answer.visible {
display: block;
}
.table-text {
display: grid;
grid-template-columns: 50% 50%;
grid-gap: none;
margin-top: 5px;
border-collapse: collapse;
}
.table-text-2 {
display: grid;
grid-template-columns: 33.33% 33.33% 33.33%;
grid-gap: none;
margin-top: 5px;
border-collapse: collapse;
}
.table-text-header,
.table-text-cell {
padding: 5px;
border: 1px solid black;
text-align: left;
}
.table-text-header {
font-weight: bold;
text-align: center;
}
.no-break {
white-space: nowrap;
}
.tab {
text-indent: 40px; /* Adjust the value as per your preference */
}
</style>
<p style="font-size: 18px; font-family: Arial; text-align: left; color: #5c5c5c; background-color: #ebeaec; padding: 10px;"> <b> <i>I. Answer any 3 questions from 1 β 5. Each carries 1 score. (3 x 1 = 3)</i> </b> </p>
<div class="box">
<div class="question">1) Some type of Orchids lives on the branches of mango trees. The relationship between mango tree and Orchid is an example of <p> a) Mutualism b) Predation <p> c) Commensalism d) Parasitism </div>
<div class="answer"><p>β
c) Commensalism </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question">2) In flowering plants, double fertilization occurs during reproduction. One of the events of double fertilization is triple fusion. Name the other event. </div>
<div class="answer"><p>β
Syngamy </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question">3) Identify palindrome sequence from the following. <p> a) 5β- GAATTC -3β <br> 3β- CTTAAG -5β <p> b) 5β- ATCG -3β <br> 3β- TAGC -5β <p> c) 5β- AAAAA -3β <br> 3β- TTTTTT -5β <p> d) 5β- CCCCC -3β <br> 3β- GGGGG -5β </div>
<div class="answer"><p>β
a) 5β- GAATTC -3β <br> 3β- CTTAAG -5β </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> 4) Which of the following is a detritivore? <p> a) Earthworm b) Virus <p> c) Fox d) Cow </div>
<div class="answer"> <p>β
a) Earthworm </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question">5) Biotechnology in agriculture leads to pest resistant plants, which could decrease the amount of pesticides used. For example, Bt cotton. Expand the letters βBβ and βtβ. </div>
<div class="answer"><p>β
B= <i>Bacillus</i> t= <i>thuringiensis</i> </div>
<button class="answer-button">View Answer</button>
</div>
<p style="font-size: 18px; font-family: Arial; text-align: left; color: #5c5c5c; background-color: #ebeaec; padding: 10px;"> <b> <i>II. Answer any 9 questions from 6 β 16. Each carries 2 scores. (9 x 2 = 18)</i> </b> </p>
<div class="box">
<div class="question"> 6) Given diagram shows an important process in biotechnology. <div class="separator" style="clear: both;"><a href="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEh8WSLd0QX4yT7-O86ndJkAtgC3Gkf7jSqR4vprADOnZlrmxoHLw9VNi9PV_MYpjO2asc6eCZafktJM055LULy8dVOyNQKFAh7FFaNVQwv0ojHAowv8hzh_0Zicp2TkKmTC7mJJkAXda38OJshsUnDiEC5ZS0pm8lBAWX6_yBTDuKucBZUjg5o0vuI9sHA/s1600/bob.jpg" style="display: block; padding: 1em 0; text-align: center; "><img alt="" border="0" data-original-height="268" data-original-width="480" src="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEh8WSLd0QX4yT7-O86ndJkAtgC3Gkf7jSqR4vprADOnZlrmxoHLw9VNi9PV_MYpjO2asc6eCZafktJM055LULy8dVOyNQKFAh7FFaNVQwv0ojHAowv8hzh_0Zicp2TkKmTC7mJJkAXda38OJshsUnDiEC5ZS0pm8lBAWX6_yBTDuKucBZUjg5o0vuI9sHA/s1600/bob.jpg"/></a></div> a. Identify the process. <p> b. Some of the events of this process are given below. Arrange them in correct order: <p> i. Cut out DNA bands <p> ii. Expose to UV <p> iii. Force DNA to move through gel <p> iv. Stain DNA with ethidium bromide </div>
<div class="answer"> <p>β
<b>Answer</b></p> (a) Gel electrophoresis. <p> (b) iii. Force DNA to move through gel β iv. Stain DNA with ethidium bromide β ii. Expose to UV β Cut out DNA bands </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> 7) Explain the equation GPP β R = NPP. </div>
<div class="answer"> <p>β
<b>Answer</b></p> <b>Gross primary productivity (GPP):</b> It is the rate of production of organic matter during photosynthesis. A considerable amount of GPP is used by plants in respiration. <p> <b>Net primary productivity (NPP):</b> It is the available biomass for the consumption to heterotrophs (herbivores & decomposers). i.e., NPP is the Gross primary productivity minus respiration losses (R). <p> <center><b>NPP = GPP β R</b></center> </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> 8) A diagram of LS of a flower showing growth of pollen tube is given below. Label A to D. <div class="separator" style="clear: both;"><a href="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEhs7c2yfU-EfIB3486zqlOWRsS8Sc8RrqLSb62tBZcRksVMyTH29VPbUac6QL12YI6zs04wN0eTCQ-rS3PbbNNJlmp4QaTDBVZ5B64-xwb89JnqDIkDIgrCBkC0ndVJnZHW6SpVZ-afYuqr0o69J_pMYYSbWTdmxVoYBd5jbtojclp22XAfEyxYacOrt78/s1600/bob.jpg" style="display: block; padding: 1em 0; text-align: center; "><img alt="" border="0" data-original-height="528" data-original-width="403" src="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEhs7c2yfU-EfIB3486zqlOWRsS8Sc8RrqLSb62tBZcRksVMyTH29VPbUac6QL12YI6zs04wN0eTCQ-rS3PbbNNJlmp4QaTDBVZ5B64-xwb89JnqDIkDIgrCBkC0ndVJnZHW6SpVZ-afYuqr0o69J_pMYYSbWTdmxVoYBd5jbtojclp22XAfEyxYacOrt78/s1600/bob.jpg"/></a></div> </div>
<div class="answer"> <p>β
<b>Answer</b></p> A= Antipodal B= Polar nuclei <p> C= Egg cell D= Synergid </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> 9) Match the column A with column B: <div class="separator" style="clear: both;"><a href="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEhn0Xti7av6H_jUhIA6Wl11lDpji-JtZkQJe8pQ9HHjjKwEkl1jF7XhQw_57Nyy_-ddIcbCHc6To92ZJPhE8nkf-PAgTS8GptMO8BolAaHj5Cu0kn-ekk_MufzCr1tB4i70WjBKLGEwZcOYMhcqVF-OQlLM1Ou4ZfQAwr0QJijk_FCaKGD9VTztvqdNZOs/s1600/bob.jpg" style="display: block; padding: 1em 0; text-align: center; "><img alt="" border="0" data-original-height="258" data-original-width="730" src="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEhn0Xti7av6H_jUhIA6Wl11lDpji-JtZkQJe8pQ9HHjjKwEkl1jF7XhQw_57Nyy_-ddIcbCHc6To92ZJPhE8nkf-PAgTS8GptMO8BolAaHj5Cu0kn-ekk_MufzCr1tB4i70WjBKLGEwZcOYMhcqVF-OQlLM1Ou4ZfQAwr0QJijk_FCaKGD9VTztvqdNZOs/s1600/bob.jpg"/></a></div> </div>
<div class="answer"> <p>β
<b>Answer</b></p> <div class="separator" style="clear: both;"><a href="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEiKbOdkH3dtZtnA716NoIDTd9C8qOfeMQl9hpCQkaHx96D5dm9VbDlXTy9_XJzVUGyeUNmTgrEekAzER-haGE2vvo9E71-TA4lhmC5MiNqxtaVjPFcX7CWMePbAijKQzGGYQUUpNfvb5c7isZLlMEtFTr2QY4ajI-X5zky1kMhmn_YmMobqDdE1T4FSM6o/s1600/bob2.png" style="display: block; padding: 1em 0; text-align: center; "><img alt="" border="0" data-original-height="184" data-original-width="553" src="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEiKbOdkH3dtZtnA716NoIDTd9C8qOfeMQl9hpCQkaHx96D5dm9VbDlXTy9_XJzVUGyeUNmTgrEekAzER-haGE2vvo9E71-TA4lhmC5MiNqxtaVjPFcX7CWMePbAijKQzGGYQUUpNfvb5c7isZLlMEtFTr2QY4ajI-X5zky1kMhmn_YmMobqDdE1T4FSM6o/s1600/bob2.png"/></a></div> </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> 10) Among many, there are two core techniques that enabled birth of modern biotechnology. Name and briefly explain them. </div>
<div class="answer"> <p>β
<b>Answer</b></p> <b>Two core techniques that enabled birth of modern biotechnology:</b> <p> <b>a. Genetic engineering:</b> The technique in which genetic material (DNA & RNA) is chemically altered and introduced into host organisms to change the phenotype. <p> <b>b. Bioprocess engineering:</b> Maintenance of sterile ambience in chemical engineering processes for growing desired microbe/eukaryotic cell for the manufacture of antibiotics, vaccines, enzymes etc. </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> 11) Flowers are classified into Chasmogamous and Cleistogamous flowers. <p> a. Cleistogamous flowers are autogamous. Justify. <p> b. Define autogamy. </div>
<div class="answer"> <p>β
<b>Answer</b></p> (a) Anthers and stigma lie close to each other. They are not exposed. <p> (b) It is the transfer of pollen grains from the anther to the stigma of the same flower. </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> 12) What is meant by Resource partitioning? Explain with an example. </div>
<div class="answer"> <p>β
<b>Answer</b></p> Resource partitioning is the division of limited resources by species to avoid competition. For this, they choose different feeding times or different foraging patterns. <p> E.g. MacArthur showed that five closely related species of warblers living on a tree could avoid competition and co-exist due to behavioural differences in their foraging activities. </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> 13) A given species may occupy more than one trophic level in the same ecosystem at the same time. Justify this statement with suitable example. </div>
<div class="answer"> <p>β
<b>Answer</b></p> This statement is true. <p> For example, a sparrow is a primary consumer when it eats seeds, fruits, peas, and a secondary consumer when it eats insects and worms. </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> 14) Prey species have evolved a variety of defense mechanisms to lessen the impact of predation. Mention any four of them. </div>
<div class="answer"> <p>β
<b>Answer</b></p> <b>Defenses of prey species to lessen impact of predation:</b> <p> β’ Camouflage (cryptic colouration) of some insects & frogs. <p> β’ Some are poisonous and so avoided by the predators. <p> β’ Monarch butterfly is highly distasteful to its predator bird. It is due to a special chemical in its body. It is acquired during its caterpillar stage by feeding on a poisonous weed. <p> β’ Thorns (Acacia, Cactus etc.) are the most common morphological means of defense of plants. </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> 15) Analyze the following diagram showing the representation of age pyramids for human population. All items are mislabeled. Correct them. <div class="separator" style="clear: both;"><a href="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEhhipv1egVaFwf5SLUGkKvFqCtFK_wtM8-SG0bGiEMXXFJKSjQGsWhJO8fK_ZvnBRqmg-BrEQfgfkRzxrBNk4VQEMNai22wqIdi5RSwYQ_Gv4Mi2OVdQc_y95SMFXormSnRa2C31SlmBKbNCL-5NMjWQRJVX5M55i2UtzYshILh8n5xtCRoOy_-obCVgj0/s1600/bob.jpg" style="display: block; padding: 1em 0; text-align: center; "><img alt="" border="0" data-original-height="243" data-original-width="987" src="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEhhipv1egVaFwf5SLUGkKvFqCtFK_wtM8-SG0bGiEMXXFJKSjQGsWhJO8fK_ZvnBRqmg-BrEQfgfkRzxrBNk4VQEMNai22wqIdi5RSwYQ_Gv4Mi2OVdQc_y95SMFXormSnRa2C31SlmBKbNCL-5NMjWQRJVX5M55i2UtzYshILh8n5xtCRoOy_-obCVgj0/s1600/bob.jpg"/></a></div> </div>
<div class="answer"> <p>β
<b>Answer</b></p> (x) Post-reproductive <p> (y) Reproductive <p> (z) Pre-reproductive <p> (a) Expanding (growing) <p> (b) Stable <p> (c) Declining </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> 16) Expand short forms used in Biotechnology. <p> A) PCR B) ELISA <p> C) GEAC D) GMO </div>
<div class="answer"> <p>β
<b>Answer</b></p> (A) Polymerase Chain Reaction <p> (B) Enzyme-Linked Immunosorbent Assay <p> (C) Genetic Engineering Approval Committee <p> (D) Genetically Modified Organisms </div>
<button class="answer-button">View Answer</button>
</div>
<p style="font-size: 18px; font-family: Arial; text-align: left; color: #5c5c5c; background-color: #ebeaec; padding: 10px;"> <b> <i>III. Answer any 3 questions from 17 β 20. Each carries 3 scores. (3 x 3 = 9)</i> </b> </p>
<div class="box">
<div class="question"> 17) Isolation of the Genetic Material (DNA) is the first step of recombinant DNA technology. Give an outline about this process. </div>
<div class="answer"> <p>β
<b>Answer</b></p> <b>Isolation of the Genetic Material (DNA):</b> <p> Treat the bacterial cells/plant or animal tissue with enzymes like <i>lysozyme</i> (bacteria), <i>cellulase</i> (plants), <i>chitinase</i> (fungus) etc. The cell is broken releasing DNA and other macromolecules (RNA, proteins, lipids & polysaccharides). <p> RNA is removed by treating with <i>ribonuclease</i>. Proteins are removed by treatment with <i>protease</i>. Other molecules are removed by appropriate treatments. <p> When chilled ethanol is added, purified DNA precipitates out as a collection of fine threads in the suspension. </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> 18) Seeds have many advantages in terms of survival and reproduction. Explain. </div>
<div class="answer"> <p>β
<b>Answer</b></p> <b>Advantages of seeds:</b> <p> β’ Since pollination and fertilisation are independent of water, seed formation is more dependable. <p> β’ Better adaptive strategies for dispersal to new habitats. It helps the species to colonize in other areas. <p> β’ They have food reserves. So seedlings are nourished until they are capable of photosynthesis. <p> β’ The hard seed coat protects the young embryo. <p> β’ Being products of sexual reproduction, they generate new genetic combinations and variations. <p> β’ Dehydration & dormancy helps to store seeds. </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> 19) (a) The pyramid of biomass in sea is generally inverted. Give reason. <p> (b) What are the limitations of ecological pyramids? </div>
<div class="answer"> <p>β
<b>Answer</b></p> (a) Because the biomass of fishes far exceeds that of phytoplankton. <p> (b) <b>Limitations of ecological pyramids:</b> <p> 1. It does not consider the same species belonging to two or more trophic levels. <p> 2. It assumes a simple food chain that never exists in nature. It does not accommodate a food web. <p> 3. Saprophytes are not included. </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> 20) (a) Describe the terms (i) Totipotency (ii) Micropropagation <p> (b) Mention any two advantages of tissue culture. </div>
<div class="answer"> <p>β
<b>Answer</b></p> (a) <b>(i) Totipotency: </b>The ability to generate a whole plant from any cell/explant is called totipotency. <p> <b>(ii) Micropropagation:</b> The method of producing thousands of plants in very short time through tissue culture is called micropropagation. <p> (b) <b>Two advantages of tissue culture:</b> <p> β’ Can produce large number of plants which are genetically identical to original plant. <p> β’ Tissue culture is used to recover healthy plants from diseased plants. </div>
<button class="answer-button">View Answer</button>
</div>
<p style="font-size: 30px; font-family: Arial; text-align: center; color: #993d77; background-color: #ffe0f4; padding: 10px;"> <b> PART B: ZOOLOGY </b></p>
<p style="font-size: 18px; font-family: Arial; text-align: left; color: #5c5c5c; background-color: #ebeaec; padding: 10px;"> <b> <i>I. Answer any 3 questions from 1 β 5. Each carries 1 score. (3 x 1 = 3)</i> </b> </p>
<div class="box">
<div class="question">1) Z-values of a frugivorous bat species are given below. Which value is not applicable to continents? <p> (a) 0.6 (b) 0.65 <p> (c) 0.2 (d) 0.68 </div>
<div class="answer"><p>β
(c) 0.2 </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question">2) Which of the following combinations do not apply to DNA? <p> (a) Deoxyribose, Guanine <p> (b) Ribose, Adenine <p> (c) Deoxyribose, Uracil <p> (d) Guanine, Thymine <p> 1. (a) and (b) 2. (b) and (c) <p> 3. (c) and (d) 4. (a) and (d) </div>
<div class="answer"><p>β
2. (b) and (c) </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question">3) Select the odd one out and justify your selection. <p> <center> Malaria, Cancer, Amoebiasis, Filariasis </center> </div>
<div class="answer"><p>β
Cancer. It is non-infectious. Others are infectious diseases. </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> 4) Feeding in the first few days is essential for preventing infections in a newly born baby. Why? </div>
<div class="answer"> <p>β
The yellowish milk (colostrum) produced during the initial few days of lactation contains several antibodies to develop immunity for newborn babies. </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question">5) Which of the following pairs of STDs is completely curable? <p> (a) HIV, Hepatitis-B <p> (b) Hepatitis-B, Gonorrhea <p> (c) Syphilis, Gonorrhea <p> (d) Chlamydomonas, genital-herpes </div>
<div class="answer"><p>β
(c) Syphilis, Gonorrhea </div>
<button class="answer-button">View Answer</button>
</div>
<p style="font-size: 18px; font-family: Arial; text-align: left; color: #5c5c5c; background-color: #ebeaec; padding: 10px;"> <b> <i>II. Answer any 9 questions from 6 β 16. Each carries 2 scores. (9 x 2 = 18)</i> </b> </p>
<div class="box">
<div class="question"> 6) Distinguish <i>in situ</i> conservation from <i>ex situ</i> conservation with one example each. </div>
<div class="answer"> <p>β
<b>Answer</b></p> <b><i>In situ</i> conservation:</b> It is the conservation of organisms in their natural habitats. E.g. National parks, Sanctuary etc. <p> <b><i>Ex situ</i> conservation:</b> It is the conservation of organisms outside their habitats. E.g. genetic resource centres, zoological parks etc. </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> 7) (a) The following table shows the F, generation of a dihybrid cross. Identify the βPhenotypeβ with homozygous recessive genotype. Find out A : B : C : D. <div class="separator" style="clear: both;"><a href="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEjnvY0UjIHbUzw0-SNFS1ucMyTiqepGhP5QmJ4Aiuq1YAly7pStJtW60ptjOhhWnYePEjyonx3xREdAyy2zif8dYMWhjt-O2RKoxngRoFndaaLKJ6hJP7UMeUpYXRgI8rTgN0hqQnmgnEN_WHZnpDjAGWYz7sndD8jrzNZChk88JTN2rrXpTjR_vkxQnLI/s1600/bob.jpg" style="display: block; padding: 1em 0; text-align: center; "><img alt="" border="0" data-original-height="202" data-original-width="517" src="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEjnvY0UjIHbUzw0-SNFS1ucMyTiqepGhP5QmJ4Aiuq1YAly7pStJtW60ptjOhhWnYePEjyonx3xREdAyy2zif8dYMWhjt-O2RKoxngRoFndaaLKJ6hJP7UMeUpYXRgI8rTgN0hqQnmgnEN_WHZnpDjAGWYz7sndD8jrzNZChk88JTN2rrXpTjR_vkxQnLI/s1600/bob.jpg"/></a></div> (b) State Mendelβs Law of Segregation. </div>
<div class="answer"> <p>β
<b>Answer</b></p> (a) Phenotype B. <p> A: B: C: D = 3:1:9:3 <p> (b) βDuring gamete formation, the factors (alleles) of a character pair present in parents segregate from each other such that a gamete receives only one of the 2 factorsβ.</div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> 8) LH and FSH are gonadotrophins. Distinguish their roles in males and females. </div>
<div class="answer"> <p>β
<b>Answer</b></p> <b>Functions of LH:</b> <p> <b>In males:</b> Acts on Leydig cells to stimulate release of androgens. <p> <b>In females: </b>Stimulates ovulation and development of corpus luteum. <p> <b>Functions of FSH:</b> <p> <b>In males:</b> Acts on Sertoli cells to stimulate release of factors for spermiogenesis <p> <b>In females:</b> Stimulates development of primary follicles to Graafian follicles. </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> 9) Examine the following fragment of beta globin chain in human haemoglobin and identify the hereditary disease with reason. <div class="separator" style="clear: both;"><a href="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEi18KNNWMvnU6nLPHT01_43c8CSWvx9PXIqlB3qf-kfv83oR2yDOIVMFlQG9GfCzMIEE5BSeGwcxZOGecCD4wy9QfNU6A7l9IGge4Vb8Onss0OHB6mtmpu-xHsirneF60pkAKufZTPtGCB6k5LJJ0VfvSw1yi8vxnfVMETXt96AuRMVl-SOIOZd1A88a6w/s1600/bob.jpg" style="display: block; padding: 1em 0; text-align: center; "><img alt="" border="0" data-original-height="140" data-original-width="900" src="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEi18KNNWMvnU6nLPHT01_43c8CSWvx9PXIqlB3qf-kfv83oR2yDOIVMFlQG9GfCzMIEE5BSeGwcxZOGecCD4wy9QfNU6A7l9IGge4Vb8Onss0OHB6mtmpu-xHsirneF60pkAKufZTPtGCB6k5LJJ0VfvSw1yi8vxnfVMETXt96AuRMVl-SOIOZd1A88a6w/s1600/bob.jpg"/></a></div></div>
<div class="answer"> <p>β
<b>Answer</b></p> Sickle cell anaemia. <p> <b>Reason:</b> Replacement of glutamic acid with valine at the 6th position of ο’-globin chain. This is due to the single base substitution at the sixth codon of the Ξ²-globin gene from GAG to GUG. </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> 10) What are the advantages of biofertilizers over chemical fertilizers? Give an example for biofertilizer. </div>
<div class="answer"> <p>β
<b>Answer</b></p> <b>Advantages of biofertilizers:</b> They are eco-friendly and improve soil. They prevent pollution. <p> E.g. <i>Rhizobium</i>, <i>Mycorrhiza</i>, Cyanobacteria etc. </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> 11) The diagram shown below represents the operation of natural selection on different traits. Observe the diagrams and answer the following. <div class="separator" style="clear: both;"><a href="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEjxKnzvb9F2cHOFM9VwOdkH6CxF1KxeOc2PedT4srxHIzIp_TXyIJHOdaE0hs8HmLguHOYwQfHofAmNXCDyF2oxT0s7e6brDpQzPabFdnJ2c61YCF3NrJlsv1mTUYF0UkAa1PGXtKKs7ECuGNbX0jZgyu8Wz2yKELZIHLawM-X5WCEnwFwreqNHm8jMdJc/s1600/bob2.png" style="display: block; padding: 1em 0; text-align: center; "><img alt="" border="0" data-original-height="1109" data-original-width="1380" src="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEjxKnzvb9F2cHOFM9VwOdkH6CxF1KxeOc2PedT4srxHIzIp_TXyIJHOdaE0hs8HmLguHOYwQfHofAmNXCDyF2oxT0s7e6brDpQzPabFdnJ2c61YCF3NrJlsv1mTUYF0UkAa1PGXtKKs7ECuGNbX0jZgyu8Wz2yKELZIHLawM-X5WCEnwFwreqNHm8jMdJc/s1600/bob2.png"/></a></div> a. The graph C shows a marked difference from graph A. why? <p> b. What is the evolutionary significance of directional selection? </div>
<div class="answer"> <p>β
<b>Answer</b></p> (a) In <b>A (Stabilizing selection),</b> more individuals acquire mean character value and variation is reduced. <p> In <b>C (Disruptive selection),</b> individuals of both extremes (peripheral character value at both ends of the distribution curve) are more favoured. <p> (b) <b>Directional selection:</b> Here, individuals of one extreme are more favoured. Directional selection drives the evolution of a population towards a specific trait. This helps organisms adapt to changing environments by increasing the prevalence of beneficial traits. </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> 12) Examine the diagram of mRNA given below. Mark the 5β and 3β ends of the mRNA by giving reasons. <div class="separator" style="clear: both;"><a href="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEh1APkm_cKDXtMtb-0SjK2en0XyAyjiqFOCggo8t1jZyYMZYuv4dKslO29CgAZS2ml10bDwQVIAOHduvAaMo8qNewi4VZD7rO5phyyB5H7iko2RS5xH19s2dvo-8VDR6ELycWkU0fd1DByADt7iKD7zpr-d_LAYeQ8FT5kDsXn9s5zGC7L3s8M5SUAepEQ/s1600/bob.jpg" style="display: block; padding: 1em 0; text-align: center; "><img alt="" border="0" data-original-height="84" data-original-width="783" src="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEh1APkm_cKDXtMtb-0SjK2en0XyAyjiqFOCggo8t1jZyYMZYuv4dKslO29CgAZS2ml10bDwQVIAOHduvAaMo8qNewi4VZD7rO5phyyB5H7iko2RS5xH19s2dvo-8VDR6ELycWkU0fd1DByADt7iKD7zpr-d_LAYeQ8FT5kDsXn9s5zGC7L3s8M5SUAepEQ/s1600/bob.jpg"/></a></div> </div>
<div class="answer"> <p>β
<b>Answer</b></p> <div class="separator" style="clear: both;"><a href="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEiA_cijv9QaCjAALkMm2sw8Pijaxv7gL0Sa0KtVhHjGRJL13zedmJn2q_hIN6ggbttyJ9YwXHAgEGb_CMc0CNAYemIhEl1mf5jWxSb_KtY2w4Lks04YFP6N59mB_1BzZqrn9_xEC0QxG0A87FkVa14rt4GoT1LHmC5yekAPCeiA2KI9pHUXoN8d3IMuhvs/s1600/bob2.png" style="display: block; padding: 1em 0; text-align: center; "><img alt="" border="0" data-original-height="69" data-original-width="496" src="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEiA_cijv9QaCjAALkMm2sw8Pijaxv7gL0Sa0KtVhHjGRJL13zedmJn2q_hIN6ggbttyJ9YwXHAgEGb_CMc0CNAYemIhEl1mf5jWxSb_KtY2w4Lks04YFP6N59mB_1BzZqrn9_xEC0QxG0A87FkVa14rt4GoT1LHmC5yekAPCeiA2KI9pHUXoN8d3IMuhvs/s1600/bob2.png"/></a></div> <b>Reason:</b> Poly adenylation always occurs at 3β end. </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> 13) Morphine is said to be an abused drug. Discriminate the terms βuseβ and βabuseβ of drugs based on this example. </div>
<div class="answer"> <p>β
<b>Answer</b></p> <b>Use of Morphine:</b> In medical field, it is used as pain killer or sedative. <p> <b>Abuse:</b> It is abused as narcotic drugs. Produces temporary euphoria and addiction. Affects CNS. </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> 14) Differentiate Active immunity from Passive immunity. Give an example for Passive immunity. </div>
<div class="answer"> <p>β
<b>Answer</b></p> <b>Active immunity: </b>It is the immunity in which antibodies are produced in a host body when the host is exposed to antigens (e.g. living or dead microbes or other proteins). <p> <b>Passive immunity:</b> Here, readymade antibodies are directly given to the body. <p> E.g. Antibodies (IgG) from mother β Placenta β Foetus, Anti-tetanus serum (ATS) etc. </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> 15) What would happen if both strands of the DNA act as template for transcription? </div>
<div class="answer"> <p>β
<b>Answer</b></p> β’ The code for proteins is different in both strands. This complicates the translation. <p> β’ If 2 RNA molecules are produced simultaneously, this would be complimentary to each other. It forms a double stranded RNA and prevents translation. </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> 16) Schematic representation of gametogenesis is given below. Identify A and B. Write one difference between A & B. <div class="separator" style="clear: both;"><a href="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEhNIljEbaENnTVmMgf12hYEbFeek1JaBA-WKTJm5Gda1ovwCcP2a-Z2d8iVHY9-IcDACW1mngcnPCI1VA7XQjHDKOO7ZqK8TrY6qd8M1dzpcMYu2bnqfwv09214Fe2zn27XVDyBi-U9RaY0dQgeUldmiiU7Eys835RJ_47uJTbY30tn-nXpcUiYroZAExY/s1600/bob.jpg" style="display: block; padding: 1em 0; text-align: center; "><img alt="" border="0" data-original-height="340" data-original-width="794" src="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEhNIljEbaENnTVmMgf12hYEbFeek1JaBA-WKTJm5Gda1ovwCcP2a-Z2d8iVHY9-IcDACW1mngcnPCI1VA7XQjHDKOO7ZqK8TrY6qd8M1dzpcMYu2bnqfwv09214Fe2zn27XVDyBi-U9RaY0dQgeUldmiiU7Eys835RJ_47uJTbY30tn-nXpcUiYroZAExY/s1600/bob.jpg"/></a></div> </div>
<div class="answer"> <p>β
<b>Answer</b></p> A= Spermatogenesis B= Oogenesis <p> <b>Spermatogenesis:</b> It occurs in testis. No polar body formation. <p> <b>Oogenesis:</b> It occurs in ovary. Polar bodies are formed.
</div>
<button class="answer-button">View Answer</button>
</div>
<p style="font-size: 18px; font-family: Arial; text-align: left; color: #5c5c5c; background-color: #ebeaec; padding: 10px;"> <b> <i>III. Answer any 3 questions from 17 β 20. Each carries 3 scores. (3 x 3 = 9)</i> </b> </p>
<div class="box">
<div class="question"> 17) One couple came to know that they have a girl child during 4th month of pregnancy and they decide to do MTP. <p> a. Expand and define MTP. <p> b. At which stage of pregnancy is MTP relatively safe? <p> c. How will you respond to the decision of female foeticide by the couple? </div>
<div class="answer"> <p>β
<b>Answer</b></p> (a) Medical Termination of Pregnancy. <p> Intentional or voluntary termination of pregnancy before full term is called MTP or induced abortion. <p> (b) At first trimester. <p> (c) The decision to terminate a pregnancy based on the gender of the child is ethically and morally problematic. Female foeticide is illegal and raises serious concerns about gender discrimination and the value placed on female lives. Also, second trimester is risky. </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> 18) In an <i>E. coli</i> culture lactose is used as food instead of glucose. If so, answer the following questions: <p> (a) How do the bacteria respond to the above situation at genetic level? <p> (b) If lactose is removed from the medium what will happen? </div>
<div class="answer"> <p>β
<b>Answer</b></p> (a) If lactose is provided, it is transported into the <i>E. coli</i>. Lactose (inducer) binds with repressor protein. So repressor protein cannot bind to operator gene. The operator gene becomes free and induces the <i>RNA polymerase</i> to bind with promoter gene. Then transcription starts. <p> (b) <i>Lac</i> operon remains switched off. The regulator gene synthesizes mRNA to produce repressor protein. This protein binds to the operator region and blocks RNA polymerase movement. So the structural genes are not expressed. </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> 19) Examine the pictures of Darwinβs Finches given below and answer the following questions: <div class="separator" style="clear: both;"><a href="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEj4jWsryJ5V_UU-vsHM9wEvapb4rXc6QjJmOT1tyGypuYyLSx8EDPaRT4Na37EWcRSj6kss6hU0HgTqsEfsDxKcWU7akJc2fYNrIw5GsLWOp_mDhjGu_hyphenhyphen0y4kzj1lAmtBsoRo44R4Pa6oU1CUq_z6TX0zhX1z0uAdnhtGH77VG4RWuNdwUjlnjiHbWlN4/s1600/bob.jpg" style="display: block; padding: 1em 0; text-align: center; "><img alt="" border="0" data-original-height="181" data-original-width="666" src="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEj4jWsryJ5V_UU-vsHM9wEvapb4rXc6QjJmOT1tyGypuYyLSx8EDPaRT4Na37EWcRSj6kss6hU0HgTqsEfsDxKcWU7akJc2fYNrIw5GsLWOp_mDhjGu_hyphenhyphen0y4kzj1lAmtBsoRo44R4Pa6oU1CUq_z6TX0zhX1z0uAdnhtGH77VG4RWuNdwUjlnjiHbWlN4/s1600/bob.jpg"/></a></div> (a) What phenomenon in evolution is represented in the picture? <p> (b) Explain the phenomenon with the help of an additional example. </div>
<div class="answer"> <p>β
<b>Answer</b></p> (a) Adaptive radiation. <p> (b) Adaptive radiation (evolution by adaptation) is the evolution of different species in a geographical area starting from a point and radiating to other areas of geography (habitats). E.g. Australian marsupials (Marsupial radiation). <p> Different types of marsupials were evolved from an ancestor but all within the Australian island continent. <p> When more than one adaptive radiation is appeared in an isolated geographical area, it results in convergent evolution. E.g. Australian Marsupials and Placental mammals. </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> 20) Some genetic abnormalities, their genotypes and features are distributed in columns A, B and C respectively. Match them correctly. <div class="separator" style="clear: both;"><a href="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEhwFFsjZDByK83aMWUZTpYSc3okT7LUJAJ9H3WN3ro03K2dLrPmN5TN7bZSadZcAHFHMqT5ZwSX7jweIAiFAeB6cEN0MBURqXxasmuFQVmOCoDwAytfMm6cQLeDyTGGIR3DXKSR9wlfmeuOsEoPBIeOzpMJJzXwocMLHhSro6sq41R9xLKx0uV7yiRCaL0/s1600/bob.jpg" style="display: block; padding: 1em 0; text-align: center; "><img alt="" border="0" data-original-height="207" data-original-width="843" src="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEhwFFsjZDByK83aMWUZTpYSc3okT7LUJAJ9H3WN3ro03K2dLrPmN5TN7bZSadZcAHFHMqT5ZwSX7jweIAiFAeB6cEN0MBURqXxasmuFQVmOCoDwAytfMm6cQLeDyTGGIR3DXKSR9wlfmeuOsEoPBIeOzpMJJzXwocMLHhSro6sq41R9xLKx0uV7yiRCaL0/s1600/bob.jpg"/></a></div> </div>
<div class="answer"> <p>β
<b>Answer</b></p> <div class="separator" style="clear: both;"><a href="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEiRzeM5bWJz3WSYkh3mdSPVui5Xh9P1oNdBTfB04Ou5afDxfm9z91jiFX-YbQUOOGczrJMGzaOCbmZN_RKKTzf9AzESyNYdSkGaFu3Pgj4T313Nn7kPQ8YR-rZXB44tFlWJ-5qeRbLUBW4EPBoAtHtZXf1_PlCNTfUmRpK7WycfdGc5Y_pTfohr5uTxzLc/s1600/bob2.png" style="display: block; padding: 1em 0; text-align: center; "><img alt="" border="0" data-original-height="211" data-original-width="832" src="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEiRzeM5bWJz3WSYkh3mdSPVui5Xh9P1oNdBTfB04Ou5afDxfm9z91jiFX-YbQUOOGczrJMGzaOCbmZN_RKKTzf9AzESyNYdSkGaFu3Pgj4T313Nn7kPQ8YR-rZXB44tFlWJ-5qeRbLUBW4EPBoAtHtZXf1_PlCNTfUmRpK7WycfdGc5Y_pTfohr5uTxzLc/s1600/bob2.png"/></a></div> </div>
<button class="answer-button">View Answer</button>
</div>
<script>
// Get all the answer buttons
const answerButtons = document.querySelectorAll('.answer-button');
// Add a click event listener to each answer button
answerButtons.forEach(button => {
button.addEventListener('click', () => {
// Get the answer section for this button
const answerSection = button.previousElementSibling;
// Toggle the answer section's visibility
answerSection.classList.toggle('visible');
// Change the button text to "Hide Answer" or "View Answer"
if (answerSection.classList.contains('visible')) {
button.textContent = 'Hide Answer';
button.classList.add('hide-answer');
} else {
button.textContent = 'View Answer';
button.classList.remove('hide-answer');
}
});
});
</script>
<html>
<head>
<style>
.special-paragraph {
margin-bottom: -10px; /* Adjust this value to reduce the space */
color: #333333;
font-family: Arial, sans-serif;
font-size: 23px;
font-weight: bold;
line-height: 1.5;
padding: 7px;
text-align: center;
border-radius: 10px;
}
.green-bg {
background-color: #ddffd9; /* Green background */
}
.blue-bg {
background-color: #b0eaff; /* Blue background */
}
</style>
</head>
<body>
<p class="special-paragraph green-bg">
<a href="https://www.bankofbiology.com/2020/10/hse-1-2-model-qp-online-exam-series.html" style="color: green;"> π Other Question Papers </a>
</p>
<p class="special-paragraph blue-bg">
<a href="https://www.bankofbiology.com/p/question-bank.html" style="color: blue;"> π Exam Special Materials </a>
</p>
</body>
</html>
<div class="blogger-post-footer"><p> Β© copyright 2024 β All rights reserved </p>
<a href=βhttps://www.bankofbiology.comβ>bankofbiology.com</a></div>Abu Raniyahttp://www.blogger.com/profile/14189496606355139812noreply@blogger.com0tag:blogger.com,1999:blog-6823671394482492613.post-70759326707438797962024-03-10T15:54:00.034+05:302024-03-11T17:39:53.252+05:30Plus Two Biology (Bot + Zoo) | Practice Model Question Paper PDF with Answer key | SET 7<!DOCTYPE html>
<html>
<head>
<title>Example Webpage</title>
<style>
body {
user-select: none; /* Prevent selection of text */
-moz-user-select: none; /* Firefox */
-webkit-user-select: none; /* Safari and Chrome */
-ms-user-select: none; /* Internet Explorer/Edge */
}
h1 {
user-select: text; /* Allow selection of title */
}
</style>
</head>
<p style="font-size: 25px; font-family: Arial; text-align: center; color: #2068d4; line-height: 1.5;"> <b> π <a href="https://drive.google.com/file/d/1D4PK53j-o4WcGkNcQ0hFkAmxqgUfs5rf/view?usp=drive_link" target="_blank">Download Biology Question Paper PDF - SET 7</a> </b> </p>
<p style="font-size: 30px; font-family: Arial; text-align: center; color: #0c8a7d; background-color: #a2f5d3; padding: 10px;"> <b> PART A: BOTANY </b></p>
<style>
/* Customize the box style */
.box {
background-color: #ffffff;
border: 1px solid #ffffff;
border-radius: 1px;
padding: 10px;
margin-bottom: 10px;
margin-right: -14px;
margin-left: -14px;
}
/* Customize the question style */
.question {
font-size: 17px;
font-weight: bold;
color: #3D4849;
font-family: Open Sans;
margin-bottom: 10px;
}
/* Customize the answer style */
.answer {
font-size: 18px;
font-weight: normal;
font-family: Roboto;
margin-bottom: 10px;
background-color: #e7ffde;
}
/* Hide the answer by default */
.answer {
display: none;
}
/* Customize the view/hide answer button */
.answer-button {
background-color: #4CAF50;
border: none;
border-radius: 5px;
color: white;
padding: 8px 16px;
text-align: center;
text-decoration: none;
display: inline-block;
font-size: 18px;
margin-bottom: 1px;
cursor: pointer;
}
/* Style the button differently when it changes to "Hide Answer" */
.answer-button.hide-answer {
background-color: #f44336;
}
/* Show the answer when the visible class is added */
.answer.visible {
display: block;
}
.table-text {
display: grid;
grid-template-columns: 50% 50%;
grid-gap: none;
margin-top: 5px;
border-collapse: collapse;
}
.table-text-2 {
display: grid;
grid-template-columns: 33.33% 33.33% 33.33%;
grid-gap: none;
margin-top: 5px;
border-collapse: collapse;
}
.table-text-header,
.table-text-cell {
padding: 5px;
border: 1px solid black;
text-align: left;
}
.table-text-header {
font-weight: bold;
text-align: center;
}
.no-break {
white-space: nowrap;
}
.tab {
text-indent: 40px; /* Adjust the value as per your preference */
}
</style>
<p style="font-size: 18px; font-family: Arial; text-align: left; color: #5c5c5c; background-color: #ebeaec; padding: 10px;"> <b> <i>I. Answer any 3 questions from 1 β 5. Each carries 1 score. (3 x 1 = 3)</i> </b> </p>
<div class="box">
<div class="question">1) After syngamy and triple fusion in embryo sac, embryo will be diploid and β¦β¦β¦β¦β¦β¦ will be triploid. </div>
<div class="answer"><p>β
Endosperm </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question">2) Natural interlinked food chains are called β¦β¦β¦β¦β¦β¦. </div>
<div class="answer"><p>β
Food web </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question">3) Fill in the blank: <p> Alpha I-antitrypsin is used to treat the disease ............... </div>
<div class="answer"><p>β
Emphysema </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> 4) Write the name of technique used to remove the DNA from the gel. </div>
<div class="answer"> <p>β
Elution </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question">5) Note the relationship of first pair and fill up the blank suitably. <p> Mortality: No. of deaths in the population during a given period. <p> β¦β¦β¦β¦β¦β¦.: No. of births in the population during a given period. </div>
<div class="answer"><p>β
Natality </div>
<button class="answer-button">View Answer</button>
</div>
<p style="font-size: 18px; font-family: Arial; text-align: left; color: #5c5c5c; background-color: #ebeaec; padding: 10px;"> <b> <i>II. Answer any 9 questions from 6 β 16. Each carries 2 scores. (9 x 2 = 18)</i> </b> </p>
<div class="box">
<div class="question"> 6) Write any three parts of a monocot embryo and write one peculiarity of each of these three parts. </div>
<div class="answer"> <p>β
<b>Answer</b></p> Scutellum: Single cotyledon. <p> Radicle: Lower end of the embryonal axis. <p> Coleorhiza: Sheath that encloses radicle. </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> 7) A list of organisms is given. Place them in different trophic levels. <p> Grass, Man, Fishes, Birds, Lion, Grasshopper, Zooplankton, Trees </div>
<div class="answer"> <p>β
<b>Answer</b></p> β’ <b>First trophic level (Producers):</b> Grass, Trees <p> β’ <b>Second trophic level (Primary Consumers):</b> Grasshopper, Zooplankton <p> β’ <b>Third trophic level (Secondary Consumers):</b> Birds, Fishes <p> β’ <b>Fourth trophic level (Tertiary Consumers):</b> Lion, Man </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> 8) Name the interaction between sea anemone and clown fish. Justify your answer with suitable explanation. </div>
<div class="answer"> <p>β
<b>Answer</b></p> <b>Name of the interaction:</b> Commensalism. <p> Clown fish protection from predators because predators stay away from the stinging tentacles of sea anemone. But sea anemone does not get any benefit from clown fish. </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> 9) How does the inactive protoxin of <i>Bacillus thuringiensis</i> gets converted into active toxin when an insect ingests it? </div>
<div class="answer"> <p>β
<b>Answer</b></p> When an insect ingests the toxin, it becomes active due to alkaline pH of the gut which solubilise the crystals. Toxin binds to surface of epithelial cells creating pores. It causes death of the insect. </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> 10) Synergids have a special cellular thickening at micropylar tip. Write the name of name and function of the structure. </div>
<div class="answer"> <p>β
<b>Answer</b></p> Filiform apparatus. It guides pollen tube into the synergids. </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> 11) A biologist studied the population of rats in a barn. <p> He found that the average natality was 250, average mortality 240, immigration 20 and emigration 30. <p> Calculate the net increase in population with suitable explanation. </div>
<div class="answer"> <p>β
<b>Answer</b></p> The net increase in population can be calculated as follows: <p> Net Increase= (Natality + Immigration) β (Mortality + Emigration) <p> Substituting the given values: <p> Net Increase= (250 + 20) β (240 + 30) = 0 <p> So net increase in population is zero. </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> 12) Given below is a data showing number of individuals and dry weight of different trophic levels in a grassland ecosystem. Construct, <p> a. Pyramid of number. <p> b. Pyramid of biomass. <div class="separator" style="clear: both;"><a href="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEgTA6wJyeAR1SjfhWE4fMTn91A2foaTBnF2tETfr6Tccjn9ZMVS982Kluq4efO2i1AR5E9uEwCUbJ4tIZFVY3bqfGtzw_1_fhwM_jeO_-0PuaWdyrNB5o5fXW6qVV8zwd_1Zx4FSDtaJr70GouK9RCRKlhCxAid3EsSHStIdwn_VLJTv-0QBJSQMq2NHYQ/s1600/bob.jpg" style="display: block; padding: 1em 0; text-align: center; "><img alt="" border="0" data-original-height="208" data-original-width="687" src="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEgTA6wJyeAR1SjfhWE4fMTn91A2foaTBnF2tETfr6Tccjn9ZMVS982Kluq4efO2i1AR5E9uEwCUbJ4tIZFVY3bqfGtzw_1_fhwM_jeO_-0PuaWdyrNB5o5fXW6qVV8zwd_1Zx4FSDtaJr70GouK9RCRKlhCxAid3EsSHStIdwn_VLJTv-0QBJSQMq2NHYQ/s1600/bob.jpg"/></a></div> </div>
<div class="answer"> <p>β
<b>Answer</b></p> (a) <b>Pyramid of number:</b> <div class="separator" style="clear: both;"><a href="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEi7BQj5sfER6zh0fz6-5dxHWZ7kOVSKNYouN2Lbu4e38prvsjqVF_BtV0aPOqfaoHbEMgB7kSsoGrKHpEqLfcBMdwsije7uHiqXUKEussTpYQ5MOAFihIN2pjfReJbRFAg55cxaX3fwflAaeaoNyxkLyBrfHNY4h4nR1_RgeEbj3yXuSUCWfcNX5Owt9Ps/s1600/bob2.png" style="display: block; padding: 1em 0; text-align: center; "><img alt="" border="0" data-original-height="250" data-original-width="534" src="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEi7BQj5sfER6zh0fz6-5dxHWZ7kOVSKNYouN2Lbu4e38prvsjqVF_BtV0aPOqfaoHbEMgB7kSsoGrKHpEqLfcBMdwsije7uHiqXUKEussTpYQ5MOAFihIN2pjfReJbRFAg55cxaX3fwflAaeaoNyxkLyBrfHNY4h4nR1_RgeEbj3yXuSUCWfcNX5Owt9Ps/s1600/bob2.png"/></a></div> (b) <b>Pyramid of biomass:</b> <div class="separator" style="clear: both;"><a href="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEjb5CiK5qp809SAdltNpMvco-bWEsYU40qIc-XB1-bZ8M24-_FwBjTF05i-GqrWDarWLBXIQ3wjpGahrphzCtnyBHm2y6DpRW-p4Nkbb5hHywiGaNAVDv2Xwj815WjHwagHmbe7MBKfMxC1vI4HQWFm4JvX27ayBCbs5xccsjHS4LsVLRg5Jl90NGUySkc/s1600/bob2.png" style="display: block; padding: 1em 0; text-align: center; "><img alt="" border="0" data-original-height="240" data-original-width="538" src="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEjb5CiK5qp809SAdltNpMvco-bWEsYU40qIc-XB1-bZ8M24-_FwBjTF05i-GqrWDarWLBXIQ3wjpGahrphzCtnyBHm2y6DpRW-p4Nkbb5hHywiGaNAVDv2Xwj815WjHwagHmbe7MBKfMxC1vI4HQWFm4JvX27ayBCbs5xccsjHS4LsVLRg5Jl90NGUySkc/s1600/bob2.png"/></a></div> </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> 13) Many countries encourage the cultivation of Genetically Modified Crops (G. M. Plants). Write any two advantages of GM plants. </div>
<div class="answer"> <p>β
<b>Answer</b></p> GM plants are <p> a. Tolerant to abiotic stresses. <p> b. Pest resistant </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> 14) Match the items of column A with B: <div class="separator" style="clear: both;"><a href="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEiO354oSRskJTpLN9rbaH5aY0U4WFOY-fbdpBXCISAjMzk6JpTehKJqitBc0Bn5lHMXJYcFKrvTlHd2au5zTjw1PhKQ6rkQBOKocnAqSkojOV6LPEd7rUfV-G0ZXvKwFl1TIXGnGd83zBT-6yOeHf-3Rd8R4THYp76Yhd0hLWD1783XrxFu0_rhDG10GMs/s1600/bob.jpg" style="display: block; padding: 1em 0; text-align: center; "><img alt="" border="0" data-original-height="210" data-original-width="655" src="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEiO354oSRskJTpLN9rbaH5aY0U4WFOY-fbdpBXCISAjMzk6JpTehKJqitBc0Bn5lHMXJYcFKrvTlHd2au5zTjw1PhKQ6rkQBOKocnAqSkojOV6LPEd7rUfV-G0ZXvKwFl1TIXGnGd83zBT-6yOeHf-3Rd8R4THYp76Yhd0hLWD1783XrxFu0_rhDG10GMs/s1600/bob.jpg"/></a></div> </div>
<div class="answer"> <p>β
<b>Answer</b></p> <div class="separator" style="clear: both;"><a href="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEikdzxAOTgy0l8Q9Km9lkAgMvha62WypxRwUWKfWZhYoeXjyjax6XqEoBQVeEfZgqHJO0EmUo8tz9lq1ifUo2DNWs27xE0rWGGY1xGU1Chq2XHGUh5aJHklgkFXNY4fxwoBo9bOqH0Hh0lbCySNPRTZe6Zv6ln3y4McRPudnK2Ud_P8snigFnZMNdVfY7A/s1600/bob2.png" style="display: block; padding: 1em 0; text-align: center; "><img alt="" border="0" data-original-height="217" data-original-width="591" src="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEikdzxAOTgy0l8Q9Km9lkAgMvha62WypxRwUWKfWZhYoeXjyjax6XqEoBQVeEfZgqHJO0EmUo8tz9lq1ifUo2DNWs27xE0rWGGY1xGU1Chq2XHGUh5aJHklgkFXNY4fxwoBo9bOqH0Hh0lbCySNPRTZe6Zv6ln3y4McRPudnK2Ud_P8snigFnZMNdVfY7A/s1600/bob2.png"/></a></div> </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> 15) Pyramid of energy is never been inverted. Why? </div>
<div class="answer"> <p>β
<b>Answer</b></p> When energy flows from a trophic level to the next higher trophic level, some energy is always lost as heat at each step. </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> 16) <i>Restriction endonuclease</i> recognises a specific sequence in the DNA. Name that sequence and write its peculiarity. </div>
<div class="answer"> <p>β
<b>Answer</b></p> Palindromic nucleotide sequence. <p> <b>Peculiarity:</b> It is a sequence of base pairs that read the same on the two strands in 5' β 3' direction and in 3' β 5' direction. </div>
<button class="answer-button">View Answer</button>
</div>
<p style="font-size: 18px; font-family: Arial; text-align: left; color: #5c5c5c; background-color: #ebeaec; padding: 10px;"> <b> <i>III. Answer any 3 questions from 17 β 20. Each carries 3 scores. (3 x 3 = 9)</i> </b> </p>
<div class="box">
<div class="question"> 17) Read the statements below and identify the mode of interaction between the species. <p> a. Tiger eating deer <p> b. Butterfly feeding pollen <p> c. Human liver fluke feed on snail <p> d. Lice on humans <p> e. Orchid attached to a tree <p> f. Mycorrhizal association of fungi and roots of higher plants <p> g. Sparrow eating seed <p> h. Egrets foraging close to cattle </div>
<div class="answer"> <p>β
<b>Answer</b></p> <b>Modes of interaction:</b> <p> a. Predation <p> b. Mutualism <p> c. Parasitism <p> d. Parasitism <p> e. Commensalism <p> f. Mutualism <p> g. Predation <p> h. Commensalism </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> 18) A novel strategy to prevent nematode manifestation is based on βRNA interferenceβ. <p> a. Explain RNA interference. <p> b. Can you suggest how it can be used for producing nematode resistant plant? </div>
<div class="answer"> <p>β
<b>Answer</b></p> (a) RNAi is a method of cellular defense in all eukaryotic organisms. It prevents translation of a specific mRNA (silencing) due to a complementary dsRNA molecule. <p> (b) Isolate Nematode-specific genes (DNA) and introduce into host plant using <i>Agrobacterium</i> vectors. It produces both sense & anti-sense RNA in host cells. These RNAs are complementary. So they form double stranded (ds) RNA. It initiates RNAi and silences the specific mRNA of nematode. Thus the parasite cannot survive in a transgenic host expressing specific interfering RNA. </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> 19) Observe the diagram given below: <div class="separator" style="clear: both;"><a href="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEh1x_n1lOIH49ULMqosU4ZwdO9yQLy9bP_9PTvL9E3uZ7mTXMaVcF91G1vtsmIrAdfP_FdFHketzTbFygGIzUmjQTbqJSJfVV14y2ICjhg1B14F24H8FSRzg4IFO_rz0LmYi-1g5FzYFh9VkgWc3wp9Zw3f4vXZTOxgw9vFtwNkzZX98_xFsqtMFq_ncI8/s1600/bob.jpg" style="display: block; padding: 1em 0; text-align: center; "><img alt="" border="0" data-original-height="350" data-original-width="320" src="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEh1x_n1lOIH49ULMqosU4ZwdO9yQLy9bP_9PTvL9E3uZ7mTXMaVcF91G1vtsmIrAdfP_FdFHketzTbFygGIzUmjQTbqJSJfVV14y2ICjhg1B14F24H8FSRzg4IFO_rz0LmYi-1g5FzYFh9VkgWc3wp9Zw3f4vXZTOxgw9vFtwNkzZX98_xFsqtMFq_ncI8/s1600/bob.jpg"/></a></div> a. Identify the diagram and the parts A, B and C. <p> b. Briefly explain the applications of this technique. </div>
<div class="answer"> <p>β
<b>Answer</b></p> (a) It is the diagrammatic representation of recombinant DNA technology. <p> A= Vector DNA (plasmid) <p> B= Recombinant DNA molecule <p> C= Transformation <p> (b) It has applications in the field of agriculture (e.g., Bt cotton), medicine (e.g., genetically engineered insulin), transgenic animals etc. </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> 20) Flowering plants evolved an array of adaptations to achieve pollination. <p> a. Explain 3 types of pollination. <p> b. Illustrate pollination in <i>Vallisnaria</i>. </div>
<div class="answer"> <p>β
<b>Answer</b></p> (a) <b>3 types of pollination:</b> <p> β’ <b>Autogamy: </b>Transfer of pollen grains from the anther to the stigma of the same flower. <p> β’ <b>Geitonogamy:</b> Transfer of pollen grains from the anther to the stigma of another flower of the same plant. <p> β’ <b>Xenogamy:</b> Transfer of pollen grains from the anther to the stigma of a different plant. <p> (b) <b>Pollination in <i>Vallisnaria</i>:</b> <p> In <i>Vallisneria</i>, the female flower reaches the surface of water by the long stalk and the male flowers or pollen grains are released on to the surface of water. They are carried by water currents and reach the female flowers. </div>
<button class="answer-button">View Answer</button>
</div>
<p style="font-size: 30px; font-family: Arial; text-align: center; color: #993d77; background-color: #ffe0f4; padding: 10px;"> <b> PART B: ZOOLOGY </b></p>
<p style="font-size: 18px; font-family: Arial; text-align: left; color: #5c5c5c; background-color: #ebeaec; padding: 10px;"> <b> <i>I. Answer any 3 questions from 1 β 5. Each carries 1 score. (3 x 1 = 3)</i> </b> </p>
<div class="box">
<div class="question">1) Observe the relationship between first pair and write the missing one. <p> Menstrual phase: 1-5<sup>th</sup> day <p> Ovulatory phase: β¦β¦β¦β¦β¦β¦. </div>
<div class="answer"><p>β
14<sup>th</sup> day </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question">2) Name the non-steroidal, once in a week pill developed by CDRI. </div>
<div class="answer"><p>β
<i>Saheli</i> </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question">3) In a DNA sample, adenine is 22%. Find out the percentage of guanine. </div>
<div class="answer"><p>β
28% </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> 4) Name the confirmatory test for typhoid fever. </div>
<div class="answer"> <p>β
Widal test </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question">5) According to Global estimate of β¦β¦β¦β¦β¦β¦., about 7 million species would have on earth. <p> a. Robert May <p> b. David Tilman <p> c. Edward Wilson <p> d. Alexander von Humboldt </div>
<div class="answer"><p>β
a. Robert May </div>
<button class="answer-button">View Answer</button>
</div>
<p style="font-size: 18px; font-family: Arial; text-align: left; color: #5c5c5c; background-color: #ebeaec; padding: 10px;"> <b> <i>II. Answer any 9 questions from 6 β 16. Each carries 2 scores. (9 x 2 = 18)</i> </b> </p>
<div class="box">
<div class="question"> 6) (a) Complete the flow chart. <div class="separator" style="clear: both;"><a href="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEjgkBxyIFXfPAPFjGBr0E87twmldO7o9dH83hSzoWe22bjk8UfuIEzlpXJQUuy_OyfDLGwQTSu9e45ZBmtLdMdMkTrZhpdQgILCvmNmq1ieiU0Pn2aVAq_EyJzgBfEhqln6xp9e2QQsghHh4yn-XlakI2I59ytb1pR1iB4yq9_x0jJOhxdxt8Ij-IeSsAs/s1600/bob.jpg" style="display: block; padding: 1em 0; text-align: center; "><img alt="" border="0" data-original-height="298" data-original-width="690" src="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEjgkBxyIFXfPAPFjGBr0E87twmldO7o9dH83hSzoWe22bjk8UfuIEzlpXJQUuy_OyfDLGwQTSu9e45ZBmtLdMdMkTrZhpdQgILCvmNmq1ieiU0Pn2aVAq_EyJzgBfEhqln6xp9e2QQsghHh4yn-XlakI2I59ytb1pR1iB4yq9_x0jJOhxdxt8Ij-IeSsAs/s1600/bob.jpg"/></a></div> (b) What is the role of LH in female reproductive system? </div>
<div class="answer"> <p>β
<b>Answer</b></p> (a) A= FSH B= Leydig cells. <p> (b) LH induces rupture of Graafian follicle and thereby ovulation. </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> 7) India achieved a lot in reproductive health through RCH programme. <p> a. Expand RCH. <p> b. Write any 2 objectives of RCH programme. </div>
<div class="answer"> <p>β
<b>Answer</b></p> (a) Reproductive and Child Health care programme. <p> (b) βͺ Give awareness to people about reproduction related aspects for creating a reproductively healthy society. <p> βͺ Educate about birth control, care of pregnant mothers, post-natal care of mother & child etc. </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> 8) Haemophilia is more common in males than in females. Justify. </div>
<div class="answer"> <p>β
<b>Answer</b></p> Haemophilia is X -linked disease. In females, haemophilia is very rare because it happens only when mother is at least carrier and father haemophilic. But in case of males, there is only one X chromosome. </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> 9) Two Pedigree charts are given below. Name the types of genetic traits shown in A & B and give suitable example for each. <div class="separator" style="clear: both;"><a href="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEgusDKxecNCBq2Ilx6eID_54PWtkgRipW2c_j72_bXpL05361_eAkREOMAoPM8yqhsjI0nGcJQgNpB2hF7ZFdBaLRI6HVgP0fQc3n3W_I4Vr-ZjwU8hZk8jdF5NkO4xk8J4X5msbfu_EuadUyUuX60K4eB5Y_fqKRhs-thDN4EEiBoWZE1yHTUkPBxpz0s/s1600/bob.jpg" style="display: block; padding: 1em 0; text-align: center; "><img alt="" border="0" data-original-height="190" data-original-width="739" src="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEgusDKxecNCBq2Ilx6eID_54PWtkgRipW2c_j72_bXpL05361_eAkREOMAoPM8yqhsjI0nGcJQgNpB2hF7ZFdBaLRI6HVgP0fQc3n3W_I4Vr-ZjwU8hZk8jdF5NkO4xk8J4X5msbfu_EuadUyUuX60K4eB5Y_fqKRhs-thDN4EEiBoWZE1yHTUkPBxpz0s/s1600/bob.jpg"/></a></div> </div>
<div class="answer"> <p>β
<b>Answer</b></p> (A) Autosomal dominant trait. E.g. Myotonic dystrophy. <p> (B) Autosomal recessive trait. E.g. Sickle-cell anaemia. </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> 10) Name the schematic structure and label A, B & C: <div class="separator" style="clear: both;"><a href="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEjlpgJPJdJC24m2W3jb6KqlpkeGU6upZgBqklUc7HPitkZtTtTNdawigUNrVZlsDNMJ_HzkIeCqBZnx7Xd2Lv7InZ2LnkZwmpG07zx_ft-RQMF4BmVsUWIhiGJ23xJON0nSLaRS75rlGbkDqiXLCmifUZo5WGjU-LJnoWzn-9EzUkYk4IjZmv_FrvprdXs/s1600/bob.jpg" style="display: block; padding: 1em 0; text-align: center; "><img alt="" border="0" data-original-height="161" data-original-width="916" src="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEjlpgJPJdJC24m2W3jb6KqlpkeGU6upZgBqklUc7HPitkZtTtTNdawigUNrVZlsDNMJ_HzkIeCqBZnx7Xd2Lv7InZ2LnkZwmpG07zx_ft-RQMF4BmVsUWIhiGJ23xJON0nSLaRS75rlGbkDqiXLCmifUZo5WGjU-LJnoWzn-9EzUkYk4IjZmv_FrvprdXs/s1600/bob.jpg"/></a></div> </div>
<div class="answer"> <p>β
<b>Answer</b></p> Transcription unit. <p> A= Promoter <p> B= Terminator <p> C= Coding strand. </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> 11) (a) Expand the term HGP. <p> (b) Name the two methodologies of HGP. </div>
<div class="answer"> <p>β
<b>Answer</b></p> (a) Human Genome Project. <p> (b) Expressed Sequence Tags (ESTs), Sequence Annotation. </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> 12) p<sup>2</sup>+2pq+q<sup>2</sup>=1 is a binomial expression regarding an evolutionary principle. <p> a. Name the evolutionary principle. <p> b. Name any two factors affecting this evolutionary principle. </div>
<div class="answer"> <p>β
<b>Answer</b></p> (a) Hardy-Weinberg principle. <p> (b) Gene migration, Genetic drift, Mutation, Genetic recombination, Natural selection (<i>Any two</i>). </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> 13) Name 2 examples for evolution due to anthropogenic action. </div>
<div class="answer"> <p>β
<b>Answer</b></p> Industrial melanism. Development of resistant varieties in organisms against herbicides, pesticides, antibiotics or drugs etc. </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> 14) Fill in the blanks: <div class="separator" style="clear: both;"><a href="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEiQKUEBQ0Rgmqr2W5bcomE9qF4RPWO5j50lKxhJTpOUUABeUb6uEVM2bP1eXoWy41F3kVckN4iyXaYDr4XxARP38jvHPhdRdFNwPqjFv0JlNRuUT14SMuD5M_ZSvFSG71c48J8BZGO6-bvEEX6Vh5iDeaM31_OIQjlUTO1u7unU4x4BuB47UdYhND1oF8E/s1600/bob.jpg" style="display: block; padding: 1em 0; text-align: center; "><img alt="" border="0" data-original-height="237" data-original-width="902" src="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEiQKUEBQ0Rgmqr2W5bcomE9qF4RPWO5j50lKxhJTpOUUABeUb6uEVM2bP1eXoWy41F3kVckN4iyXaYDr4XxARP38jvHPhdRdFNwPqjFv0JlNRuUT14SMuD5M_ZSvFSG71c48J8BZGO6-bvEEX6Vh5iDeaM31_OIQjlUTO1u7unU4x4BuB47UdYhND1oF8E/s1600/bob.jpg"/></a></div> </div>
<div class="answer"> <p>β
<b>Answer</b></p> (A) Cellular barrier. <p> (B) Cytokine barrier. <p> (C) Skin, Mucus coating. <p> (D) Gastric HCl, saliva, tear etc. </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> 15) In sewage treatment plants, the Secondary treatment is also known as biological treatment. Write the steps involved in it. </div>
<div class="answer"> <p>β
<b>Answer</b></p> Primary effluent β Aeration tank β Action of flocs β BOD decreases β Settling tank β Effluent to water bodies β Sedimentation of flocs (activated sludge) β Anaerobic sludge digesters </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> 16) When we move towards polar regions from tropical regions there is a gradual decrease in biodiversity. Give two reasons for this. </div>
<div class="answer"> <p>β
<b>Answer</b></p> Biodiversity (species richness) is higher in tropics than polar or temperate regions because <p> a. Tropics had more evolutionary time. <p> b. Relatively constant environment (less seasonal). <p> c. They receive more solar energy which contributes to greater productivity. </div>
<button class="answer-button">View Answer</button>
</div>
<p style="font-size: 18px; font-family: Arial; text-align: left; color: #5c5c5c; background-color: #ebeaec; padding: 10px;"> <b> <i>III. Answer any 3 questions from 17 β 20. Each carries 3 scores. (3 x 3 = 9)</i> </b> </p>
<div class="box">
<div class="question"> 17) Placenta act as a physiological connection between mother and foetus. <p> a. Write any 2 functions of Placenta other than hormone secretion. <p> b. Name the placental hormones. </div>
<div class="answer"> <p>β
<b>Answer</b></p> (a) Supply O2, nutrients etc. from mother to foetus. <p> Remove CO2 and excretory wastes from foetus. <p> (b) Human chorionic gonadotropin (hCG), human placental lactogen (hPL), oestrogens, progesterone & relaxin. </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> 18) Fill the columns appropriately. <div class="separator" style="clear: both;"><a href="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEjh9JFgtbFIotdXgizRyh_8Q-Fuov1CKabEADZodRfrEhTAtHzXFJmMsQFs5RegXQNlk_MPggiIZtYyznfiDLc2r37JEjcvF0BcCRLyL6uAi2WOR-mBxahegW9pIRz_DzLE-bARFwYct-NuZpPZOhJMh7wTyps2-msqiMG6XWSgmSnsKdWZsP4y6afqQSw/s1600/bob.jpg" style="display: block; padding: 1em 0; text-align: center; "><img alt="" border="0" data-original-height="225" data-original-width="950" src="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEjh9JFgtbFIotdXgizRyh_8Q-Fuov1CKabEADZodRfrEhTAtHzXFJmMsQFs5RegXQNlk_MPggiIZtYyznfiDLc2r37JEjcvF0BcCRLyL6uAi2WOR-mBxahegW9pIRz_DzLE-bARFwYct-NuZpPZOhJMh7wTyps2-msqiMG6XWSgmSnsKdWZsP4y6afqQSw/s1600/bob.jpg"/></a></div> </div>
<div class="answer"> <p>β
<b>Answer</b></p> A= Downβs syndrome. <p> B= Short statured with small round head etc. <p> C= Klinefelterβs syndrome <p> D= 44 A + XXY <p> E= 44 A + X0 <p> F= Sterile, Ovaries are rudimentary etc. </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> 19) Diagram of <i>lac</i> operon is given: <div class="separator" style="clear: both;"><a href="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEg1F8fRCctRdIyio-KfLSKUqiXTeiSBUnlZek4TBAQ1ywt8iTwhyNhX5w_0Xp8uAt8TIQ2-2a3kosMki6ni5Ry2U7Q_0SsA9x0tZH2RLpXKaTjDYWA-HeMrLKyMnabeyX3O0y4dm-sIu-gTBx0yZHpSN0obzY6ZqVlwxZdciDndOBxfKFxYX7-uoo490h8/s1600/bob.jpg" style="display: block; padding: 1em 0; text-align: center; "><img alt="" border="0" data-original-height="302" data-original-width="905" src="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEg1F8fRCctRdIyio-KfLSKUqiXTeiSBUnlZek4TBAQ1ywt8iTwhyNhX5w_0Xp8uAt8TIQ2-2a3kosMki6ni5Ry2U7Q_0SsA9x0tZH2RLpXKaTjDYWA-HeMrLKyMnabeyX3O0y4dm-sIu-gTBx0yZHpSN0obzY6ZqVlwxZdciDndOBxfKFxYX7-uoo490h8/s1600/bob.jpg"/></a></div> a. Name the inducer of <i>lac</i> operon. <p> b. Redraw the <i>lac</i> operon in presence of inducer. </div>
<div class="answer"> <p>β
<b>Answer</b></p> (a) Lactose. <p> (b) <i><b>Lac</b></i> <b>operon in presence of inducer:</b> <div class="separator" style="clear: both;"><a href="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEhcheV9Ln_SUyw9RbAw-r5Ozp2R1IKEN_RnTJFTP1oL6idGor8JqaSLbDVLVrA3JwaLJ5wPAfpALbfQs2TWPdcUU7AQdT7V7M6sk5XEHdT61CcdOmUoGI-HjhzKTVsIVyC_89Ajn4eRt8FeA5xyWdc2GL601N-ModbEg5az607pEOOO_ssXqzR7MJIIX8E/s1600/bob2.png" style="display: block; padding: 1em 0; text-align: center; "><img alt="" border="0" data-original-height="373" data-original-width="769" src="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEhcheV9Ln_SUyw9RbAw-r5Ozp2R1IKEN_RnTJFTP1oL6idGor8JqaSLbDVLVrA3JwaLJ5wPAfpALbfQs2TWPdcUU7AQdT7V7M6sk5XEHdT61CcdOmUoGI-HjhzKTVsIVyC_89Ajn4eRt8FeA5xyWdc2GL601N-ModbEg5az607pEOOO_ssXqzR7MJIIX8E/s1600/bob2.png"/></a></div> </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> 20) (a) Carcinogens are cancer causing agents. Write different types of carcinogens. <p> (b) What is meant by metastasis? </div>
<div class="answer"> <p>β
<b>Answer</b></p> (a) <b>Physical agents:</b> E.g. Ionizing radiations like X-rays and gamma rays and non-ionizing radiations. <p> <b>Chemical agents:</b> Tobacco smoke, vinyl chloride, nicotine etc. <p> <b>Biological agents:</b> E.g. oncogenic viruses, c-onc (cellular oncogenes) etc. <p> (b) Cells sloughed from tumours reach other sites via blood where they form a new tumour. It is called metastasis. </div>
<button class="answer-button">View Answer</button>
</div>
<script>
// Get all the answer buttons
const answerButtons = document.querySelectorAll('.answer-button');
// Add a click event listener to each answer button
answerButtons.forEach(button => {
button.addEventListener('click', () => {
// Get the answer section for this button
const answerSection = button.previousElementSibling;
// Toggle the answer section's visibility
answerSection.classList.toggle('visible');
// Change the button text to "Hide Answer" or "View Answer"
if (answerSection.classList.contains('visible')) {
button.textContent = 'Hide Answer';
button.classList.add('hide-answer');
} else {
button.textContent = 'View Answer';
button.classList.remove('hide-answer');
}
});
});
</script>
<html>
<head>
<style>
.special-paragraph {
margin-bottom: -10px; /* Adjust this value to reduce the space */
color: #333333;
font-family: Arial, sans-serif;
font-size: 23px;
font-weight: bold;
line-height: 1.5;
padding: 7px;
text-align: center;
border-radius: 10px;
}
.green-bg {
background-color: #ddffd9; /* Green background */
}
.blue-bg {
background-color: #b0eaff; /* Blue background */
}
</style>
</head>
<body>
<p class="special-paragraph green-bg">
<a href="https://www.bankofbiology.com/2020/10/hse-1-2-model-qp-online-exam-series.html" style="color: green;"> π Other Question Papers </a>
</p>
<p class="special-paragraph blue-bg">
<a href="https://www.bankofbiology.com/p/question-bank.html" style="color: blue;"> π Exam Special Materials </a>
</p>
</body>
</html>
<div class="blogger-post-footer"><p> Β© copyright 2024 β All rights reserved </p>
<a href=βhttps://www.bankofbiology.comβ>bankofbiology.com</a></div>Abu Raniyahttp://www.blogger.com/profile/14189496606355139812noreply@blogger.com0tag:blogger.com,1999:blog-6823671394482492613.post-89874294919529376042024-03-09T20:49:00.038+05:302024-03-10T11:41:51.804+05:30Plus Two Biology (Bot + Zoo) | Practice Model Question Paper PDF with Answer key | SET 6<!DOCTYPE html>
<html>
<head>
<title>Example Webpage</title>
<style>
body {
user-select: none; /* Prevent selection of text */
-moz-user-select: none; /* Firefox */
-webkit-user-select: none; /* Safari and Chrome */
-ms-user-select: none; /* Internet Explorer/Edge */
}
h1 {
user-select: text; /* Allow selection of title */
}
</style>
</head>
<p style="font-size: 25px; font-family: Arial; text-align: center; color: #2068d4; line-height: 1.5;"> <b> π <a href="https://drive.google.com/file/d/1D4-QTBNP4mncgiHKCWFVDNX0OH9yQ0br/view?usp=sharing" target="_blank">Download Biology Question Paper PDF - SET 6</a> </b> </p>
<p style="font-size: 30px; font-family: Arial; text-align: center; color: #0c8a7d; background-color: #a2f5d3; padding: 10px;"> <b> PART A: BOTANY </b></p>
<style>
/* Customize the box style */
.box {
background-color: #ffffff;
border: 1px solid #ffffff;
border-radius: 1px;
padding: 10px;
margin-bottom: 10px;
margin-right: -14px;
margin-left: -14px;
}
/* Customize the question style */
.question {
font-size: 17px;
font-weight: bold;
color: #3D4849;
font-family: Open Sans;
margin-bottom: 10px;
}
/* Customize the answer style */
.answer {
font-size: 18px;
font-weight: normal;
font-family: Roboto;
margin-bottom: 10px;
background-color: #e7ffde;
}
/* Hide the answer by default */
.answer {
display: none;
}
/* Customize the view/hide answer button */
.answer-button {
background-color: #4CAF50;
border: none;
border-radius: 5px;
color: white;
padding: 8px 16px;
text-align: center;
text-decoration: none;
display: inline-block;
font-size: 18px;
margin-bottom: 1px;
cursor: pointer;
}
/* Style the button differently when it changes to "Hide Answer" */
.answer-button.hide-answer {
background-color: #f44336;
}
/* Show the answer when the visible class is added */
.answer.visible {
display: block;
}
.table-text {
display: grid;
grid-template-columns: 50% 50%;
grid-gap: none;
margin-top: 5px;
border-collapse: collapse;
}
.table-text-2 {
display: grid;
grid-template-columns: 33.33% 33.33% 33.33%;
grid-gap: none;
margin-top: 5px;
border-collapse: collapse;
}
.table-text-header,
.table-text-cell {
padding: 5px;
border: 1px solid black;
text-align: left;
}
.table-text-header {
font-weight: bold;
text-align: center;
}
.no-break {
white-space: nowrap;
}
.tab {
text-indent: 40px; /* Adjust the value as per your preference */
}
</style>
<p style="font-size: 18px; font-family: Arial; text-align: left; color: #5c5c5c; background-color: #ebeaec; padding: 10px;"> <b> <i>I. Answer any 3 questions from 1 β 5. Each carries 1 score. (3 x 1 = 3)</i> </b> </p>
<div class="box">
<div class="question">1) A date palm seed discovered during archeological investigation retained viability even after 10000 years. The retention of viability is due to the state of inactivity of embryo called β¦β¦β¦β¦β¦β¦. </div>
<div class="answer"><p>β
Seed Dormancy </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question">2) Sequences of base pairs in DNA that reads the same on both the strands when the orientation of reading is kept the same are called β¦β¦β¦β¦β¦β¦. sequences. </div>
<div class="answer"><p>β
Palindromic sequence </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question">3) In a given habitat, the maximum number possible for a species is called β¦β¦β¦β¦β¦β¦. of that species in that habitat. </div>
<div class="answer"><p>β
Carrying capacity. </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> 4) Name a source of pest resistant gene. </div>
<div class="answer"> <p>β
<i>Bacillus thuringiensis</i> </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question">5) Observe the following food chain: <div class="separator" style="clear: both;"><a href="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEjrC90mrDIQdGKcZfR-m57ZbGcqK9BGHhUZ_Xt9n0X8omE_hl2pxsjsU_ADqRGFXRRZkqXwEecFXCRbdIFNgFudt0nCoWGv4Icg3SmpXY_lHRw2kgLF2_EfVzKzfYVNRVOffhkyYNuCkSIRiIxuOntnJ1y7wR_ijnf3XOvUaTbOO7ZA8QT7y9-S-PlRwJs/s1600/bob.jpg" style="display: block; padding: 1em 0; text-align: center; "><img alt="" border="0" data-original-height="90" data-original-width="793" src="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEjrC90mrDIQdGKcZfR-m57ZbGcqK9BGHhUZ_Xt9n0X8omE_hl2pxsjsU_ADqRGFXRRZkqXwEecFXCRbdIFNgFudt0nCoWGv4Icg3SmpXY_lHRw2kgLF2_EfVzKzfYVNRVOffhkyYNuCkSIRiIxuOntnJ1y7wR_ijnf3XOvUaTbOO7ZA8QT7y9-S-PlRwJs/s1600/bob.jpg"/></a></div> What is this type of food chain called? </div>
<div class="answer"><p>β
Grazing food chain (GFC) </div>
<button class="answer-button">View Answer</button>
</div>
<p style="font-size: 18px; font-family: Arial; text-align: left; color: #5c5c5c; background-color: #ebeaec; padding: 10px;"> <b> <i>II. Answer any 9 questions from 6 β 16. Each carries 2 scores. (9 x 2 = 18)</i> </b> </p>
<div class="box">
<div class="question"> 6) Using genetically modified crops, farmers can minimize use of insecticides and pesticides during cultivation. <p> a. Give name of one such genetically modified pest resistant crop. <p> b. Which gene is used for its production? <p> c. Write about its mode of action. </div>
<div class="answer"> <p>β
<b>Answer</b></p> (a) Bt cotton. <p> (b) <i>Cry</i> genes from <i>Bacillus thuringiensis. </i> <p> (c) When an insect ingests the Bt toxin, it becomes active due to alkaline pH of the gut which solubilise the crystals. Toxin binds to surface of mid-gut epithelial cells creating pores. It causes cell swelling and lysis and death of the insect. </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> 7) In large number of plants, pollination is carried out by insects. List four characters of flowers that help insect pollination. </div>
<div class="answer"> <p>β
<b>Answer</b></p> <b>Characters of insect pollinated flower:</b> <p> a. Large, colourful, fragrant and rich in nectar. Nectar & pollen grains are the floral rewards for pollination. <p> b. Small flowers form inflorescence to make them visible. <p> c. The flowers pollinated by flies and beetles secrete foul odours to attract these animals. <p> d. The pollen grains are generally sticky. </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> 8) EcoRI is a restriction endonuclease. What do E, Co, R, I represent? </div>
<div class="answer"> <p>β
<b>Answer</b></p> E = <i>Escherichia</i> (Genus name of bacteria) <p> Co = <i>Coli</i> (Species name of bacteria) <p> R = Strain <p> I = First extracted enzyme (Order of extraction). </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> 9) The following graph shows two types of pollution growth curves. <div class="separator" style="clear: both;"><a href="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEjCaRgbQ1cP2dbVBR6a6n2eHbs4l2HA-9e4W-DPz2E7KXtMrrI6_LliwS_UWDB74qvCuiXN13os8fTTA_SOFjLUXA3toYBAH4ueKremOoySNIEqQ3vIF-Ud4Pxujsj6AJnaUFK0K4yMzyDdyTyU4ICrFDnTFI3UYG-LcgzSUOhx8Mn2V7p7BIc_VAU13LM/s1600/bob.jpg" style="display: block; padding: 1em 0; text-align: center; "><img alt="" border="0" data-original-height="342" data-original-width="487" src="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEjCaRgbQ1cP2dbVBR6a6n2eHbs4l2HA-9e4W-DPz2E7KXtMrrI6_LliwS_UWDB74qvCuiXN13os8fTTA_SOFjLUXA3toYBAH4ueKremOoySNIEqQ3vIF-Ud4Pxujsj6AJnaUFK0K4yMzyDdyTyU4ICrFDnTFI3UYG-LcgzSUOhx8Mn2V7p7BIc_VAU13LM/s1600/bob.jpg"/></a></div> a. Name the growth curves. <p> b. What does K stand for?
</div>
<div class="answer"> <p>β
<b>Answer</b></p> (a) Exponential (Geometric) growth curve and Logistic (Sigmoid) growth curve. <p> (b) Carrying capacity. </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> 10) Given number of individuals in a grass land ecosystem. <p> <center> Grasshopper β 1500 <p> Grass β 5,842,000 <p> Wolf β 28 <p> Birds β 215 </center> <p> a. Draw a pyramid of numbers showing various trophic levels. <p> b. Explain trophic level. </div>
<div class="answer"> <p>β
<b>Answer</b></p> (a) <div class="separator" style="clear: both;"><a href="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEjazYSdFVj_VC_NYho16jgMI1uKTdfskFrz3RmwROU7F4-AuSoEFzQ3u5qbTPGzrIdqiFm_itwu3Ul_4CRWqzjE5ntlbyjdURQhW8FQvci-td8Zg-RLAO-HfiMHffwy2eSznIQ0-5qCHu_WvlWQmwizzoHcWcGk1G07dd-e_2EXehtI20ysroYZIXAEfco/s1600/bob2.png" style="display: block; padding: 1em 0; text-align: center; "><img alt="" border="0" data-original-height="268" data-original-width="440" src="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEjazYSdFVj_VC_NYho16jgMI1uKTdfskFrz3RmwROU7F4-AuSoEFzQ3u5qbTPGzrIdqiFm_itwu3Ul_4CRWqzjE5ntlbyjdURQhW8FQvci-td8Zg-RLAO-HfiMHffwy2eSznIQ0-5qCHu_WvlWQmwizzoHcWcGk1G07dd-e_2EXehtI20ysroYZIXAEfco/s1600/bob2.png"/></a></div> (b) A specific place of organisms in the food chain is known as their trophic level. </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> 11) Nita found that her grandma used to inject human insulin that is genetically engineered. She wants to know how such insulin can be produced. Give her an idea about structure of insulin and production of genetically engineered insulin. </div>
<div class="answer"> <p>β
<b>Answer</b></p> Insulin consists of two short polypeptide chains such as chain A and chain B. They are linked by disulphide bridges. <p> Two DNA sequences corresponding to A and B, chains of human insulin are prepared and inserted into E. coli plasmids to produce insulin chains. Chains A and B are extracted and combined by creating disulfide bonds to form human insulin. </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> 12) In rice, the chromosome number present in the meiocyte is 24. Give the number of chromosomes present in the following. Justify your answer. <p> a. rice pollen b. rice endosperm </div>
<div class="answer"> <p>β
<b>Answer</b></p> a. <b>Rice Pollen:</b> The rice pollen is a haploid cell, so it contains half the number of chromosomes as the meiocyte. Therefore, it has 12 chromosomes. <p> b. <b>Rice Endosperm:</b> The rice endosperm is a triploid cell, so it contains one and a half times the number of chromosomes as the meiocyte. Therefore, it has 36 chromosomes. </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> 13) How can we make a host cell competent to receive a foreign gene or DNA? </div>
<div class="answer"> <p>β
<b>Answer</b></p> Treating the cells with specific concentration of a divalent cation such as calcium. <p> Incubating the cells with recombinant DNA on ice. Place them briefly at 42Β°C (heat shock). Again, place them back on ice. </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> 14) Rate of biomass production is called productivity and it can be divided into GPP and NPP. <p> a. Define GPP and NPP. <p> b. How can we relate GPP and NPP? </div>
<div class="answer"> <p>β
<b>Answer</b></p> (a) <b>Gross primary productivity (GPP):</b> It is the rate of production of organic matter during photosynthesis. A considerable amount of GPP is used by plants in respiration. <p> <b>Net primary productivity (NPP):</b> It is the available biomass for the consumption to heterotrophs (herbivores & decomposers). <p> (b) NPP is the Gross primary productivity minus respiration losses (R). <p> <center> NPP = GPP β R </center> </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> 15) Humification leads to accumulation of a dark-coloured amorphous substance. Identity the substance and its peculiarities. </div>
<div class="answer"> <p>β
<b>Answer</b></p> The substance is Humus. <p> <b>Peculiarities:</b> <p> It is highly resistant to microbial action and decomposition. <p> Serves as a reservoir of nutrients. <p> Release inorganic nutrients. </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> 16) Differentiate natality and mortality. Write the alphabets used to indicate natality and mortality. </div>
<div class="answer"> <p>β
<b>Answer</b></p> <b>Natality:</b> It is the number of births in a population during a given period. <p> <b>Mortality:</b> It is the number of deaths in a population during a given period. <p> Natality is indicated by the letter B. <p> Mortality is indicated by the letter D. </div>
<button class="answer-button">View Answer</button>
</div>
<p style="font-size: 18px; font-family: Arial; text-align: left; color: #5c5c5c; background-color: #ebeaec; padding: 10px;"> <b> <i>III. Answer any 3 questions from 17 β 20. Each carries 3 scores. (3 x 3 = 9)</i> </b> </p>
<div class="box">
<div class="question"> 17) Students involved in nature club activity found some inter-specific interactions between organisms in a garden area. They made a table of interaction giving β+β for beneficial interaction, β-β for detrimental and β0β for neutral interaction. <div class="separator" style="clear: both;"><a href="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEiXkq7xrxVkGjeSPqPOuzEPwUJDpEYPV2gDKhxTuNVzxa_JSthI8zKGZwJw_PG1mDYDrQmGcGlAv0vFpXjK0Fu3wty0_bQmLJxGnq1WeqLlzYzMixvvTvJMJOcfkvThWocw5K6esdTojwUKKAS-6y3SkPTyCN35WabAglOauHJSOZQ8g19FG3EJ4xqKZDE/s1600/bob.jpg" style="display: block; padding: 1em 0; text-align: center; "><img alt="" border="0" data-original-height="180" data-original-width="337" src="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEiXkq7xrxVkGjeSPqPOuzEPwUJDpEYPV2gDKhxTuNVzxa_JSthI8zKGZwJw_PG1mDYDrQmGcGlAv0vFpXjK0Fu3wty0_bQmLJxGnq1WeqLlzYzMixvvTvJMJOcfkvThWocw5K6esdTojwUKKAS-6y3SkPTyCN35WabAglOauHJSOZQ8g19FG3EJ4xqKZDE/s1600/bob.jpg"/></a></div> a. Give name of interaction in each case. <p> b. Explain how parasitism differs from predation. <p> c. Give the significance of species interaction. </div>
<div class="answer"> <p>β
<b>Answer</b></p> (a) i. Mutualism <p> ii. Competition <p> iii. Commensalism <p> iv. Amensalism <p> (b) <b>Predation:</b> A predator kills and consumes its prey. <p> <b>Parasitism:</b> A parasite lives off a host, causing harm but not immediate death. <p> (c) It is essential to form a biological community, for energy flow and nutrient cycling. </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> 18) (a) Match the Column A with Column B. <div class="separator" style="clear: both;"><a href="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEjCpOArFGl_mbQ1zoVgDMPl1mbXyE9spW_nA-FJQZGWRxMBAlkxQghH50DxqbFtK6TeNULxRYLIpqURBNktZsVsO7MSbVERtA009IEcSNBOufearbuRoW9EbPryWrXv6MokMnNhCdAWSd3Zwym8kymlr4_KqDJwSl7JYDw6WAJnFy_NrFe0jTSsDSm9uiA/s1600/bob.jpg" style="display: block; padding: 1em 0; text-align: center; "><img alt="" border="0" data-original-height="208" data-original-width="633" src="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEjCpOArFGl_mbQ1zoVgDMPl1mbXyE9spW_nA-FJQZGWRxMBAlkxQghH50DxqbFtK6TeNULxRYLIpqURBNktZsVsO7MSbVERtA009IEcSNBOufearbuRoW9EbPryWrXv6MokMnNhCdAWSd3Zwym8kymlr4_KqDJwSl7JYDw6WAJnFy_NrFe0jTSsDSm9uiA/s1600/bob.jpg"/></a></div> (b) What is the principle of ELISA? </div>
<div class="answer"> <p>β
<b>Answer</b></p> (a) <div class="separator" style="clear: both;"><a href="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEhJGN5fkN37yM6qYYKmN2mPz5Gj-WU67KtZmVbki7_WUjoGW2GxZdVer1uJfA5Tqx2F7yxF4yHVi3_6wAnD2MAR_yZIArRJ5QH2zegd2ldErCzndJj9u9L1Ha2PtWtiuhwLw-IDDWHcdCHZK3DLK25iKe5WN8ZOvt88QfEnC7pkVX6Z3-H1oIXSvTLHnqw/s1600/bob2.png" style="display: block; padding: 1em 0; text-align: center; "><img alt="" border="0" data-original-height="219" data-original-width="715" src="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEhJGN5fkN37yM6qYYKmN2mPz5Gj-WU67KtZmVbki7_WUjoGW2GxZdVer1uJfA5Tqx2F7yxF4yHVi3_6wAnD2MAR_yZIArRJ5QH2zegd2ldErCzndJj9u9L1Ha2PtWtiuhwLw-IDDWHcdCHZK3DLK25iKe5WN8ZOvt88QfEnC7pkVX6Z3-H1oIXSvTLHnqw/s1600/bob2.png"/></a></div> (b) It is based on the antigen β antibody interaction </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> 19) Identify the following figure and label A to E. <div class="separator" style="clear: both;"><a href="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEgthyphenhyphenIUN5A1reEGyYpxlyuTT5BL4N-3jgj58YGVDDrnOgdcKdNjBTE2ULnGXaVoIq1DELkAYHpA_YKWNqHvQkeMSkbdrtF0lPZhJpa26gTD2Bb2_inQ7SivHE5yAEtGSTmzHIJJtHGBa1cU19TVLLdEPQAITjo8QDgF7Ni1XG7xmL9cd8E2R3EH-ZT8Dbg/s1600/bob2.png" style="display: block; padding: 1em 0; text-align: center; "><img alt="" border="0" data-original-height="438" data-original-width="344" src="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEgthyphenhyphenIUN5A1reEGyYpxlyuTT5BL4N-3jgj58YGVDDrnOgdcKdNjBTE2ULnGXaVoIq1DELkAYHpA_YKWNqHvQkeMSkbdrtF0lPZhJpa26gTD2Bb2_inQ7SivHE5yAEtGSTmzHIJJtHGBa1cU19TVLLdEPQAITjo8QDgF7Ni1XG7xmL9cd8E2R3EH-ZT8Dbg/s1600/bob2.png"/></a></div> </div>
<div class="answer"> <p>β
<b>Answer</b></p> It is a diagrammatic representation of the mature embryo sac. <p> A= Antipodals <p> B= Polar nuclei <p> C= Egg <p> D= Synergids <p> E= Filiform apparatus </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> 20) While studying nucleotide sequence, Raj found that following sequence which can be recognized by some enzymes: <p> <center> 5β β GAATTC β 3β <p> 3β β CTTAAG β 5β </center> <p> a. Give salient features of this sequence. <p> b. Write name of enzymes which recognize such sequences. <p> c. Elaborate importance of this enzyme in Genetic engineering. </div>
<div class="answer"> <p>β
<b>Answer</b></p> (a) Palindromic sequence <p> (b) EcoRI <i>Restriction endonuclease</i> <p> (c) This enzyme cuts at specific nucleotide sequence to get sticky ends. The same restriction enzyme is used to cut both foreign DNA and cloning vector. This helps to create recombinant DNA. </div>
<button class="answer-button">View Answer</button>
</div>
<p style="font-size: 30px; font-family: Arial; text-align: center; color: #993d77; background-color: #ffe0f4; padding: 10px;"> <b> PART B: ZOOLOGY </b></p>
<p style="font-size: 18px; font-family: Arial; text-align: left; color: #5c5c5c; background-color: #ebeaec; padding: 10px;"> <b> <i>I. Answer any 3 questions from 1 β 5. Each carries 1 score. (3 x 1 = 3)</i> </b> </p>
<div class="box">
<div class="question">1) The implanted stage during embryonic development is <p> a. Gastrula b. Morula <p> c. Zygote d. Blastocyst </div>
<div class="answer"><p>β
d. Blastocyst </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question">2) Select the initiation codon from the triplet codons given below: <p> a. AAA b. AUG <p> c. GUA d. UGA </div>
<div class="answer"><p>β
b. AUG </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question">3) Pick out the odd one giving reason. <p> a. HIV b. Haemophilia <p> c. Genital warts d. Hepatitis B </div>
<div class="answer"><p>β
Haemophilia. It is a genetic disorder. Others are STIs. </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> 4) Scientist who proposed Rivet Popper Hypothesis is β¦β¦β¦β¦β¦β¦β¦. </div>
<div class="answer"> <p>β
Paul Ehrlich. </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question">5) Expand the following terms: <p> a. MALT b. NACO </div>
<div class="answer"><p>β
a. Mucosa Associated Lymphoid Tissues. <p> b. National AIDS Control Organisation. </div>
<button class="answer-button">View Answer</button>
</div>
<p style="font-size: 18px; font-family: Arial; text-align: left; color: #5c5c5c; background-color: #ebeaec; padding: 10px;"> <b> <i>II. Answer any 9 questions from 6 β 16. Each carries 2 scores. (9 x 2 = 18)</i> </b> </p>
<div class="box">
<div class="question"> 6) When the urine sample of a lady was tested, presence of HCG was found. <p> a) Expand HCG. <p> b) What does the presence of HCG indicate? <p> c) Which is the source of HCG? </div>
<div class="answer"> <p>β
<b>Answer</b></p> a) Human Chorionic Gonadotropin <p> b) She is pregnant. <p> c) Placenta. </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> 7) CuT is a contraceptive device. <p> a. Suggest the contraceptive action of CuT. <p> b. Name the hormone releasing IUDs. </div>
<div class="answer"> <p>β
<b>Answer</b></p> a) Cu ions suppress motility and fertilising capacity of sperms. <p> b) Progestasert, LNG-20. </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> 8) As part of a dispute of parentage, the Court put an order to conduct a test for proving the father of the child. <p> a. Name the test used. <p> b. Procedure of the test is given below. Complete it. <p> i. Isolation of DNA <p> ii. DNA is cut using <i>restriction endonuclease</i> <p> iii. β¦β¦β¦β¦β¦β¦β¦ <p> iv. β¦β¦β¦β¦β¦β¦β¦ <p> v. Hybridisation using VNTR probe <p> vi. β¦β¦β¦β¦β¦β¦β¦. </div>
<div class="answer"> <p>β
<b>Answer</b></p> a) DNA fingerprinting. <p> b) iii. Separation of DNA fragments by gel electrophoresis. <p> iv. Transfer of separated DNA fragments into nitrocellulose or nylon membrane. <p> vi. Detection of DNA using autoradiography. </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> 9) Observe the figure given below: <div class="separator" style="clear: both;"><a href="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEii7rK1nVg7Dr6rb59l_U87483FtjlFbEWJhIKoO2WhmC3C9ToIGhbtTtJtnXNtUYrm_bSg5F3tBLOwzGqZzCeJnDcpOfcDVJ7aqUCGuIkZ1LEpZhXvinMTNup93e8mHFINSlNjb9AQnnoXt0dsZLiRHS-at-eSlPQeafuPqeMQzatYk0RTYXJ9nim6-c0/s1600/bob.jpg" style="display: block; padding: 1em 0; text-align: center; "><img alt="" border="0" data-original-height="409" data-original-width="484" src="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEii7rK1nVg7Dr6rb59l_U87483FtjlFbEWJhIKoO2WhmC3C9ToIGhbtTtJtnXNtUYrm_bSg5F3tBLOwzGqZzCeJnDcpOfcDVJ7aqUCGuIkZ1LEpZhXvinMTNup93e8mHFINSlNjb9AQnnoXt0dsZLiRHS-at-eSlPQeafuPqeMQzatYk0RTYXJ9nim6-c0/s1600/bob.jpg"/></a></div> a. Identify the figure. <p> b. How many histone molecules are present in the histone core? <p> c. Distinguish Euchromatin and Heterochromatin. </div>
<div class="answer"> <p>β
<b>Answer</b></p> a) Nucleosome. <p> b) 8 <p> c) <b>Euchromatin:</b> Loosely packed, light stained and transcriptionally active chromatin. <p> <b>Heterochromatin:</b> Densely packed, dark stained and transcriptionally inactive chromatin. </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> 10) Distinguish Darwinian variation and Mutational variation. (<i>Any 4 differences</i>). </div>
<div class="answer"> <p>β
<b>Answer</b></p> <b>Darwinian variations:</b> These are minor, slow and directional. It results in gradual evolution. <p> <b>Mutational variations:</b> These are sudden, random and directional. Speciation is by saltation. </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> 11) State whether the following statements are true or false. If false, rewrite them by changing the word underlined. <p> a. Double helical model of DNA was proposed by <u> Jacob and Monod. </u> <p> b. Sugar present in RNA is <u> Ribose.</u> <p> c. <u> Introns </u> are the coding sequences of a eukaryotic gene. <p> d. DNA replication occurs by <u> semi-conservative method.</u> </div>
<div class="answer"> <p>β
<b>Answer</b></p> a) False. Double helical model of DNA was proposed by <u> Watson and Crick.</u> <p> b) True. <p> c) False. <u> Exons </u> are the coding sequences of a eukaryotic gene. <p> d) True. </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> 12) During a monohybrid cross involving a tall pea plant, the offspring population were tall and dwarf in equal ratios. Work out a cross to show it is possible. </div>
<div class="answer"> <p>β
<b>Answer</b></p> <div class="separator" style="clear: both;"><a href="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEjiDR4A-DhtUeP2xuGMGcYPS1Ef-HKtu2KXSQlTVGFzlYCZdhjg40_YcEhwrwV4sDapA4V33oOYxC4rlSMMApKnUYwrEq_Dg_GmcER3ud1zbLgxI2PHW6BKlAzC757qu9K_MnYFXlLgXpt0ZG1vtY8LR3rXoT-zrN1T9TSHMA5j-78TRVA1N3NcL5cLhhI/s1600/bob2.png" style="display: block; padding: 1em 0; text-align: center; "><img alt="" border="0" data-original-height="269" data-original-width="763" src="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEjiDR4A-DhtUeP2xuGMGcYPS1Ef-HKtu2KXSQlTVGFzlYCZdhjg40_YcEhwrwV4sDapA4V33oOYxC4rlSMMApKnUYwrEq_Dg_GmcER3ud1zbLgxI2PHW6BKlAzC757qu9K_MnYFXlLgXpt0ZG1vtY8LR3rXoT-zrN1T9TSHMA5j-78TRVA1N3NcL5cLhhI/s1600/bob2.png"/></a></div> Hence monohybrid test cross ratio= 1:1 </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> 13) Stanley Miller set up an experimental apparatus as shown below. <div class="separator" style="clear: both;"><a href="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEj12U7GCvIemv34SnyI7qOWOJqRcx8aBdlXPT2vwRaYVFICeOp3mezgW9mL_PV9tsvh1afgW5evyHrEuGv3vfkAvlKspHfiVxj3Xvtm9umdqb3A5RHs19KWm8pU92P-fTm5FOUjrvLlLydG1bhiCm6gA7Xb_IkQOdakv7i3rjHz7cCJ96Qm1SJUn7Qan2I/s1600/bob.jpg" style="display: block; padding: 1em 0; text-align: center; "><img alt="" border="0" data-original-height="691" data-original-width="765" src="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEj12U7GCvIemv34SnyI7qOWOJqRcx8aBdlXPT2vwRaYVFICeOp3mezgW9mL_PV9tsvh1afgW5evyHrEuGv3vfkAvlKspHfiVxj3Xvtm9umdqb3A5RHs19KWm8pU92P-fTm5FOUjrvLlLydG1bhiCm6gA7Xb_IkQOdakv7i3rjHz7cCJ96Qm1SJUn7Qan2I/s1600/bob.jpg"/></a></div> a. Which theory was proven by this experiment? <p> b. State that theory and name the scientists who proposed it. </div>
<div class="answer"> <p>β
<b>Answer</b></p> a) Theory of Chemical Evolution. <p> b) It states that the first form of life was originated from non-living inorganic & organic molecules. <p> This theory was proposed by Oparin and Haldane. </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> 14) Read the principle and answer the questions: <p> β<i>Allele frequencies in a population are stable and is constant from generation to generation.</i>β <p> a. Name the principle mentioned here. <p> b. Mention any three factors that affect the equilibrium. </div>
<div class="answer"> <p>β
<b>Answer</b></p> a) Hardy-Weinberg Principle. <p> b) Gene migration, genetic drift, Mutation, Natural selection etc. </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> 15) In an <i>E. coli</i> culture, lactose is used as food instead of glucose. <p> a. How do the bacteria respond to the above situation at genetic level? <p> b. If lactose is removed from the medium, what will happen? </div>
<div class="answer"> <p>β
<b>Answer</b></p> a) In <i>E. coli</i>, <i>lac</i> operon will be switched on. Lactose (inducer) binds with repressor protein. So repressor protein cannot bind to operator region. It induces the <i>RNA polymerase</i> to bind with promoter. Then transcription starts. <p> b) If lactose is removed, <i>lac</i> operon remains switched off. The regulator gene synthesizes mRNA to produce repressor protein. This protein binds to the operator region and blocks <i>RNA polymerase</i> movement. So the structural genes are not expressed. </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> 16) (a) Expand STDs. <p> (b) A person has earlier symptoms of STDs. What will happen if he/she does not consult a doctor? (<i>Mention any two consequences</i>). </div>
<div class="answer"> <p>β
<b>Answer</b></p> a) Sexually Transmitted Diseases. <p> b) Pelvic Inflammatory Diseases (PID), Infertility, Ectopic Pregnancy, abortions, still births, cancer of the reproductive tract etc. </div>
<button class="answer-button">View Answer</button>
</div>
<p style="font-size: 18px; font-family: Arial; text-align: left; color: #5c5c5c; background-color: #ebeaec; padding: 10px;"> <b> <i>III. Answer any 3 questions from 17 β 20. Each carries 3 scores. (3 x 3 = 9)</i> </b> </p>
<div class="box">
<div class="question"> 17) Blood of a man is tested positive for cannabinoid. <p> a. What are these? <p> b. Mention any 4 ill-effects of alcoholism. </div>
<div class="answer"> <p>β
<b>Answer</b></p> a) Cannabinoids are a group of drugs obtained from <i>Cannabis sativa</i>. E.g., marijuana, hashish, ganja. <p> b) β’ Reckless behaviour, vandalism and violence. <p> β’ Coma and death. <p> β’ Damage of nervous system and liver cirrhosis. <p> β’ Mental and social distress to family and friends. </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> 18) The diagrammatic representation of a process in bacteria is given below: <div class="separator" style="clear: both;"><a href="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEiGacvYN64ymjIwLHt6KVuDJ7TzgkZN2ereuRrHSgT2AaYW4BApBt_e5BiUWlzFJxIbyOfBKaNCWWPtdYpZ-34ayMH4y3o6bDRkn3Pvt7OLHuRvPkLaAaS_chIo_NpqnZl7eKOkCRfCxgCPpsDRoa4O2jeqitCxBeyTIa_Oi1fK9LL9iYpew8YH2QuhGeg/s1600/bob.jpg" style="display: block; padding: 1em 0; text-align: center; "><img alt="" border="0" data-original-height="422" data-original-width="467" src="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEiGacvYN64ymjIwLHt6KVuDJ7TzgkZN2ereuRrHSgT2AaYW4BApBt_e5BiUWlzFJxIbyOfBKaNCWWPtdYpZ-34ayMH4y3o6bDRkn3Pvt7OLHuRvPkLaAaS_chIo_NpqnZl7eKOkCRfCxgCPpsDRoa4O2jeqitCxBeyTIa_Oi1fK9LL9iYpew8YH2QuhGeg/s1600/bob.jpg"/></a></div> a. Identify the process. <p> b. Name the enzyme involved in this process. <p> c. Explain the three major steps in this process. </div>
<div class="answer"> <p>β
<b>Answer</b></p> a) Transcription. <p> b) <i>RNA polymerase</i>. <p> c) Initiation, Elongation, Termination. <p> β’ <b>Initiation:</b> Here, <i>RNA polymerase</i> binds at the promoter site of DNA. An initiation factor (Ο factor) present in <i>RNA polymerase</i> initiates the RNA synthesis. <p> β’ <b>Elongation:</b> RNA chain is synthesized in 5β-3β direction. Ribonucleoside triphosphates are added. <p> β’ <b>Termination:</b> A termination factor (Ο factor) binds to the <i>RNA polymerase</i> and terminates the transcription. </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> 19) Mention and explain three arguments of the reasons for biodiversity conservation. </div>
<div class="answer"> <p>β
<b>Answer</b></p> Three arguments of the reasons for biodiversity conservation: <p> a. <b>Narrowly utilitarian arguments:</b> Human derive economic benefits from nature. <p> b. <b>Broadly utilitarian arguments:</b> Biodiversity has ecosystem services. E.g. production of O2, Pollination, Aesthetic pleasures. <p> c. <b>Ethical arguments:</b> Every species has an intrinsic value. We have to care them. </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> 20) (a) Mention any two properties of an ideal contraceptive. <p> (b) Categorise the given birth control methods into two groups under proper headings. <p> <center> Cervical caps, vasectomy, diaphragms, condoms, tubectomy </center> </div>
<div class="answer"> <p>β
<b>Answer</b></p> a) User-friendly, easily available, effective and reversible, no or least side-effects etc. <div class="separator" style="clear: both;"><a href="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEgiTCV6_TIhX3ueoAo0wZ3ZdXGBA3QVDBawS6eq-ZQmMV71eCdnApXXezAPUpY9vMHXuRfCTXmaP0vVLaHEIqgyhCZ_2osdBwF_nRchbFKToKn5fzYNgWJsclez_aVB20b0nVSb0KBP3ZwvtmhWXTp_5MkN0XxAyZkUkJ3wUxBza5tnxrB_xOVG92qdCd4/s1600/bob2.png" style="display: block; padding: 1em 0; text-align: center; "><img alt="" border="0" data-original-height="162" data-original-width="424" src="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEgiTCV6_TIhX3ueoAo0wZ3ZdXGBA3QVDBawS6eq-ZQmMV71eCdnApXXezAPUpY9vMHXuRfCTXmaP0vVLaHEIqgyhCZ_2osdBwF_nRchbFKToKn5fzYNgWJsclez_aVB20b0nVSb0KBP3ZwvtmhWXTp_5MkN0XxAyZkUkJ3wUxBza5tnxrB_xOVG92qdCd4/s1600/bob2.png"/></a></div> </div>
<button class="answer-button">View Answer</button>
</div>
<script>
// Get all the answer buttons
const answerButtons = document.querySelectorAll('.answer-button');
// Add a click event listener to each answer button
answerButtons.forEach(button => {
button.addEventListener('click', () => {
// Get the answer section for this button
const answerSection = button.previousElementSibling;
// Toggle the answer section's visibility
answerSection.classList.toggle('visible');
// Change the button text to "Hide Answer" or "View Answer"
if (answerSection.classList.contains('visible')) {
button.textContent = 'Hide Answer';
button.classList.add('hide-answer');
} else {
button.textContent = 'View Answer';
button.classList.remove('hide-answer');
}
});
});
</script>
<html>
<head>
<style>
.special-paragraph {
margin-bottom: -10px; /* Adjust this value to reduce the space */
color: #333333;
font-family: Arial, sans-serif;
font-size: 23px;
font-weight: bold;
line-height: 1.5;
padding: 7px;
text-align: center;
border-radius: 10px;
}
.green-bg {
background-color: #ddffd9; /* Green background */
}
.blue-bg {
background-color: #b0eaff; /* Blue background */
}
</style>
</head>
<body>
<p class="special-paragraph green-bg">
<a href="https://www.bankofbiology.com/2020/10/hse-1-2-model-qp-online-exam-series.html" style="color: green;"> π Other Question Papers </a>
</p>
<p class="special-paragraph blue-bg">
<a href="https://www.bankofbiology.com/p/question-bank.html" style="color: blue;"> π Exam Special Materials </a>
</p>
</body>
</html>
<div class="blogger-post-footer"><p> Β© copyright 2024 β All rights reserved </p>
<a href=βhttps://www.bankofbiology.comβ>bankofbiology.com</a></div>Abu Raniyahttp://www.blogger.com/profile/14189496606355139812noreply@blogger.com0tag:blogger.com,1999:blog-6823671394482492613.post-53613012919977266532024-03-09T09:38:00.048+05:302024-03-09T13:57:25.450+05:30Plus Two Biology (Bot + Zoo) | Practice Model Question Paper PDF with Answer key | SET 5<!DOCTYPE html>
<html>
<head>
<title>Example Webpage</title>
<style>
body {
user-select: none; /* Prevent selection of text */
-moz-user-select: none; /* Firefox */
-webkit-user-select: none; /* Safari and Chrome */
-ms-user-select: none; /* Internet Explorer/Edge */
}
h1 {
user-select: text; /* Allow selection of title */
}
</style>
</head>
<p style="font-size: 25px; font-family: Arial; text-align: center; color: #2068d4; line-height: 1.5;"> <b> π <a href="https://drive.google.com/file/d/1D269NJVgXXiP-A7SYxyQQbt-IBpdgCcF/view?usp=sharing" target="_blank">Download Biology Question Paper PDF - SET 5</a> </b> </p>
<p style="font-size: 30px; font-family: Arial; text-align: center; color: #0c8a7d; background-color: #a2f5d3; padding: 10px;"> <b> PART A: BOTANY </b></p>
<style>
/* Customize the box style */
.box {
background-color: #ffffff;
border: 1px solid #ffffff;
border-radius: 1px;
padding: 10px;
margin-bottom: 10px;
margin-right: -14px;
margin-left: -14px;
}
/* Customize the question style */
.question {
font-size: 17px;
font-weight: bold;
color: #3D4849;
font-family: Open Sans;
margin-bottom: 10px;
}
/* Customize the answer style */
.answer {
font-size: 18px;
font-weight: normal;
font-family: Roboto;
margin-bottom: 10px;
background-color: #e7ffde;
}
/* Hide the answer by default */
.answer {
display: none;
}
/* Customize the view/hide answer button */
.answer-button {
background-color: #4CAF50;
border: none;
border-radius: 5px;
color: white;
padding: 8px 16px;
text-align: center;
text-decoration: none;
display: inline-block;
font-size: 18px;
margin-bottom: 1px;
cursor: pointer;
}
/* Style the button differently when it changes to "Hide Answer" */
.answer-button.hide-answer {
background-color: #f44336;
}
/* Show the answer when the visible class is added */
.answer.visible {
display: block;
}
.table-text {
display: grid;
grid-template-columns: 50% 50%;
grid-gap: none;
margin-top: 5px;
border-collapse: collapse;
}
.table-text-2 {
display: grid;
grid-template-columns: 33.33% 33.33% 33.33%;
grid-gap: none;
margin-top: 5px;
border-collapse: collapse;
}
.table-text-header,
.table-text-cell {
padding: 5px;
border: 1px solid black;
text-align: left;
}
.table-text-header {
font-weight: bold;
text-align: center;
}
.no-break {
white-space: nowrap;
}
.tab {
text-indent: 40px; /* Adjust the value as per your preference */
}
</style>
<p style="font-size: 18px; font-family: Arial; text-align: left; color: #5c5c5c; background-color: #ebeaec; padding: 10px;"> <b> <i>I. Answer any 3 questions from 1 β 5. Each carries 1 score. (3 x 1 = 3)</i> </b> </p>
<div class="box">
<div class="question">1) In Maize, the chromosome number present in the meiocyte is 20. Give the number of chromosomes present in the following: <p> a. Maize pollen <p> b. Maize endosperm </div>
<div class="answer"><p>β
(a) 10 (b) 30
</div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question">2) DNA fragments can be seen as bright orange-coloured bands when they are stained with β¦β¦β¦β¦β¦β¦. and exposed to UV radiation. </div>
<div class="answer"><p>β
Ethidium bromide </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question">3) Of the incident solar radiation, less than 50% is β¦β¦β¦β¦β¦β¦. </div>
<div class="answer"><p>β
Photosynthetically active radiation (PAR). </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> 4) Expand GEAC. </div>
<div class="answer"> <p>β
Genetic Engineering Approval Committee </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question">5) The expansion of distributional range of a species when the competing species is removed is called β¦β¦β¦β¦β¦β¦. </div>
<div class="answer"><p>β
Competitive release. </div>
<button class="answer-button">View Answer</button>
</div>
<p style="font-size: 18px; font-family: Arial; text-align: left; color: #5c5c5c; background-color: #ebeaec; padding: 10px;"> <b> <i>II. Answer any 9 questions from 6 β 16. Each carries 2 scores. (9 x 2 = 18)</i> </b> </p>
<div class="box">
<div class="question"> 6) Raju went to a Rice Research station on his study tour. There he noticed a scientist working on rice plants using scissors and forceps. To his surprise he saw the scientist covering the inflorescence with paper bags. <p> a. Name the techniques the scientist was doing. <p> b. Give the purpose of these techniques. </div>
<div class="answer"> <p>β
<b>Answer</b></p> (a) Emasculation and bagging for artificial hybridisation. <p> (b) <b>Purpose of Emasculation:</b> Removal of anthers from the bisexual flower bud of female parent before the anther dehisces. <p> <b>Purpose of Bagging:</b> Emasculated flowers are covered with a bag to prevent contamination of stigma with unwanted pollen. </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> 7) Observe the diagram given below: <div class="separator" style="clear: both;"><a href="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEjmn8KL5FaEmCtdwVOeA1YcFPkaNbta6RyGa2r1gMUiWqb0AxBPHE2dhe09pWsgl8GttiF5g6z-tuUcQCaWZEb2BRb87MaxJYUZCSual9A8kQpemnEfQy8xJIr4kwIvG5HYKo1Tvxt545rxBlh3PKjqdMLCzwt4X3lZW5rv87C-9tKLQDKjkWIbgdSWJT0/s1600/bob.jpg" style="display: block; padding: 1em 0; text-align: center; "><img alt="" border="0" data-original-height="709" data-original-width="910" src="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEjmn8KL5FaEmCtdwVOeA1YcFPkaNbta6RyGa2r1gMUiWqb0AxBPHE2dhe09pWsgl8GttiF5g6z-tuUcQCaWZEb2BRb87MaxJYUZCSual9A8kQpemnEfQy8xJIr4kwIvG5HYKo1Tvxt545rxBlh3PKjqdMLCzwt4X3lZW5rv87C-9tKLQDKjkWIbgdSWJT0/s1600/bob.jpg"/></a></div>a. What does the given picture indicate? <p> b. In this process, three steps occur simultaneously. Name them. </div>
<div class="answer"> <p>β
<b>Answer</b></p> (a) Decomposition cycle in a terrestrial ecosystem <p> (b) Fragmentation, Leaching and catabolism. </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> 8) In human beings, certain diseases are caused due to genetic disorders. <p> a. Name the method that allows the correction of a gene defect that has been diagnosed in a child or embryo. <p> b. How this method has been used for treating ADA (Adenosine deaminase) deficiency? </div>
<div class="answer"> <p>β
<b>Answer</b></p> (a) Gene therapy. <p> (b) Gene therapy for ADA deficiency: Collect lymphocytes from the patientβs blood and grow in a culture β Introduce a functional ADA cDNA into lymphocytes (using a retroviral vector) β return them to the patient. </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> 9) Infection by nematodes causes threat to cultivation and yield loss of tobacco plants. A strategy has been developed at RNA level to control this infestation. <p> a. Name the process. <p> b. Explain how this process works at the molecular level. </div>
<div class="answer"> <p>β
<b>Answer</b></p> (a) RNA interference (RNAi) strategy. <p> (b) Isolate Nematode-specific genes (DNA) and introduce into host plant using Agrobacterium vectors. It produces both sense & anti-sense RNA in host cells. These RNAs are complementary. So they form double stranded (ds) RNA. It initiates RNAi and silences the specific mRNA of nematode. Thus the parasite cannot survive in a transgenic host expressing specific interfering RNA. </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> 10) What is meant by bioreactors? Name the most commonly used type of bioreactors. </div>
<div class="answer"> <p>β
<b>Answer</b></p> Bioreactors are the vessels in which raw materials are biologically converted to specific products, enzymes etc., using microbial, plant, animal or human cells. The most commonly used bioreactors are of stirring type (stirred-tank bioreactor). </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> 11) In a marine ecosystem, a population of phytoplankton (150,000) supports a standing crop of fishes (40,000). <p> a. Draw the pyramid of biomass and <p> b. The pyramid of numbers in this ecosystem. </div>
<div class="answer"> <p>β
<b>Answer</b></p> <div class="separator" style="clear: both;"><a href="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEgHfdNFEM8XUmzZ4yC-aVbHkR-t88uJa54ZwX3NSAE2wUY2Giz0lv2ywZ2TnCvN09C2sXKmL1gIKcxU83iaZJcy0uV5dREkHUCjaSv2w0_Uoeyqn6Xp1e6dk0CNPcqQ8t_0-WRwpMJGmkP-QdWG9qFNhEdrq9NmZPCAdPbZAFOTsO6_31UvGw1DIku8nYU/s1600/bob2.png" style="display: block; padding: 1em 0; text-align: center; "><img alt="" border="0" data-original-height="415" data-original-width="958" src="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEgHfdNFEM8XUmzZ4yC-aVbHkR-t88uJa54ZwX3NSAE2wUY2Giz0lv2ywZ2TnCvN09C2sXKmL1gIKcxU83iaZJcy0uV5dREkHUCjaSv2w0_Uoeyqn6Xp1e6dk0CNPcqQ8t_0-WRwpMJGmkP-QdWG9qFNhEdrq9NmZPCAdPbZAFOTsO6_31UvGw1DIku8nYU/s1600/bob2.png"/></a></div> </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> 12) Observe the diagram of enlarged view of a microsporangium showing wall layers. Label A, B, C & D. <div class="separator" style="clear: both;"><a href="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEhrMFaf5HDbhqJadFCtJ_RYWnKNrh6RvUJ65pZNWAu-PHF7QISpN0Nw_MpygRkEygXewuog2-Vq2k2R9g_gh9RmvUn17H5ra_BDgvEjcQiDAu-EyoRvQCcNoMrhIamBot1BZJlswqRe1EKr0PIOHS2R0tpms-uQnKlY0cHa9C3yaEKvMciW6S-rk714PMA/s1600/bob.jpg" style="display: block; padding: 1em 0; text-align: center; "><img alt="" border="0" data-original-height="362" data-original-width="307" src="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEhrMFaf5HDbhqJadFCtJ_RYWnKNrh6RvUJ65pZNWAu-PHF7QISpN0Nw_MpygRkEygXewuog2-Vq2k2R9g_gh9RmvUn17H5ra_BDgvEjcQiDAu-EyoRvQCcNoMrhIamBot1BZJlswqRe1EKr0PIOHS2R0tpms-uQnKlY0cHa9C3yaEKvMciW6S-rk714PMA/s1600/bob.jpg"/></a></div> </div>
<div class="answer"> <p>β
<b>Answer</b></p> A= Endothecium <p> B= Middle layers <p> C= Microspore mother cells <p> D= Tapetum </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> 13) Rashid isolated a natural plasmid from a bacterium and planning to facilitate cloning. What are the minimum requirements for considering the isolated plasmid as a vector? </div>
<div class="answer"> <p>β
<b>Answer</b></p> <b>Origin of Replication (ori):</b> This allows the plasmid to replicate independently within the host organism. <p> <b>Selectable Marker:</b> It allows for identification of transformed cells. <p> <b>Multiple cloning Sites:</b> It facilitates the insertion of foreign DNA. </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> 14) Predators in nature are βprudentβ. Explain. </div>
<div class="answer"> <p>β
<b>Answer</b></p> If a predator overexploits its prey, then the prey might become extinct. It results in the extinction of predator. Therefore, predators in nature are βprudentβ. </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> 15) Briefly explain Connellβs field experiments. </div>
<div class="answer"> <p>β
<b>Answer</b></p> <b>Connellβs field experiments: </b>On the rocky sea coasts of Scotland, there are 2 barnacle species: <i>Balanus</i> (larger & competitively superior) & <i>Chthamalus</i> (smaller). <p> <i>Balanus</i> dominates intertidal area and excludes <i>Chthamalus</i>. When Connell experimentally removed <i>Balanus</i>, <i>Chthamalus</i> colonized the intertidal zone. </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> 16) Pond performs all the functions of an ecosystem. Justify. </div>
<div class="answer"> <p>β
<b>Answer</b></p> Pond performs all the functions of an ecosystem. For example, <p> β’ Autotrophs convert inorganic into organic material using solar radiant energy. <p> β’ Heterotrophs consume the autotrophs. <p> β’ Decomposition and mineralization of the dead matter to release them back for reuse by the autotrophs. </div>
<button class="answer-button">View Answer</button>
</div>
<p style="font-size: 18px; font-family: Arial; text-align: left; color: #5c5c5c; background-color: #ebeaec; padding: 10px;"> <b> <i>III. Answer any 3 questions from 17 β 20. Each carries 3 scores. (3 x 3 = 9)</i> </b> </p>
<div class="box">
<div class="question"> 17) Copy the picture given below and mark the following: <div class="separator" style="clear: both;"><a href="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEiHDUaLDLnB0chmOCYAwdS2_jLcjx1f3_ZgoL0Hb0lGkE0IcVhKsT7AX_5l3SlKdHS7sXTokGq1PiyKNN5KBABQIxuXBPkasha5Xv2YF4pSjx4aDYajRCXAcjZdQzwAW9n99M_H5ozK3H73x__NOuVPThyphenhyphenrpa93C7kKf5HnLbPsxuPgqE97jTc6P1mmpoY/s1600/bob.jpg" style="display: block; padding: 1em 0; text-align: center; "><img alt="" border="0" data-original-height="376" data-original-width="259" src="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEiHDUaLDLnB0chmOCYAwdS2_jLcjx1f3_ZgoL0Hb0lGkE0IcVhKsT7AX_5l3SlKdHS7sXTokGq1PiyKNN5KBABQIxuXBPkasha5Xv2YF4pSjx4aDYajRCXAcjZdQzwAW9n99M_H5ozK3H73x__NOuVPThyphenhyphenrpa93C7kKf5HnLbPsxuPgqE97jTc6P1mmpoY/s1600/bob.jpg"/></a></div> a. Hilum <p> b. Funicle <p> c. Micropylar pole <p> d. Nucellus <p> e. Embryo sac <p> f. Chalazal pole </div>
<div class="answer"> <p>β
<b>Answer</b></p> <div class="separator" style="clear: both;"><a href="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEjzwN925g6uFibQYo6CYpHRz91KwTPChJ5hBVk2DAeNwK-q7jBjErvGhSJCjAnHyWLb7XLXSscJTTwWLUD9cmwqczYytP71NWOJwellHWUG-7ReKQTDNLVR_CNvsFGy9Yt0XaSWh3gufKRIMRRHpH8F7W_SftnfCQVQKuXk_KUSJjp65Ts8QvfyTaClp1Q/s1600/bob2.png" style="display: block; padding: 1em 0; text-align: center; "><img alt="" border="0" data-original-height="438" data-original-width="489" src="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEjzwN925g6uFibQYo6CYpHRz91KwTPChJ5hBVk2DAeNwK-q7jBjErvGhSJCjAnHyWLb7XLXSscJTTwWLUD9cmwqczYytP71NWOJwellHWUG-7ReKQTDNLVR_CNvsFGy9Yt0XaSWh3gufKRIMRRHpH8F7W_SftnfCQVQKuXk_KUSJjp65Ts8QvfyTaClp1Q/s1600/bob2.png"/></a></div> </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> 18) Interspecific interaction arises from the interaction of populations of two different species. If we assign + for beneficial, - for detrimental and 0 for neutral interactions, copy and complete the following chart. <div class="separator" style="clear: both;"><a href="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEiiHTDjCthFrD2JWn1xjcvWcuvBmctINc6lo6opkGjJTZw8h_F_-PrW4AS02Rx7eM7biItGklhdjBFZnef-sNb4JjQ05zWbeSpVrPtxnqS_Vk53baTFwn9jhW62GLjf2SR2RbN-8zJe1ZqupZuN5A5pnzCngrFzEArmlLpVobVJA65FJYFhc45J7g3trnk/s1600/bob.jpg" style="display: block; padding: 1em 0; text-align: center; "><img alt="" border="0" data-original-height="208" data-original-width="537" src="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEiiHTDjCthFrD2JWn1xjcvWcuvBmctINc6lo6opkGjJTZw8h_F_-PrW4AS02Rx7eM7biItGklhdjBFZnef-sNb4JjQ05zWbeSpVrPtxnqS_Vk53baTFwn9jhW62GLjf2SR2RbN-8zJe1ZqupZuN5A5pnzCngrFzEArmlLpVobVJA65FJYFhc45J7g3trnk/s1600/bob.jpg"/></a></div></div>
<div class="answer"> <p>β
<b>Answer</b></p> <div class="separator" style="clear: both;"><a href="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEhzzgprl7jheUeeLoDeSsHSfUtNURDpLpm699AiYYSgnKpxQZrLT1LB6hWH2whfSPI2UbLBwUneKpmfucpLAeq-e-TZYR9wyxSi8Pn5uyM2lPgeAtR033JQONQAIBsbZ1RfhEKLo1wtDu2I4EkeqH0w836lRe3c4O9FA5BnAFjpYKSwaVRA-cXdccfLmd0/s1600/bob.jpg" style="display: block; padding: 1em 0; text-align: center; "><img alt="" border="0" data-original-height="193" data-original-width="489" src="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEhzzgprl7jheUeeLoDeSsHSfUtNURDpLpm699AiYYSgnKpxQZrLT1LB6hWH2whfSPI2UbLBwUneKpmfucpLAeq-e-TZYR9wyxSi8Pn5uyM2lPgeAtR033JQONQAIBsbZ1RfhEKLo1wtDu2I4EkeqH0w836lRe3c4O9FA5BnAFjpYKSwaVRA-cXdccfLmd0/s1600/bob.jpg"/></a></div>
</div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> 19) <i>Restriction endonucleases</i> are the enzymes used to cut the DNA molecules. <p> a. Give the general terms for the specific sequences where these enzymes cut the DNA. <p> b. Name the enzyme that joins the foreign DNA and vector DNA. <p> c. Give any two procedures to introduce the recombinant DNA into the host cell. </div>
<div class="answer"> <p>β
<b>Answer</b></p> (a) Recognition sites or restriction sites. <p> (b) <i>DNA ligase</i>. <p> (c) <b>Micro-injection:</b> In this, recombinant DNA is directly injected into the nucleus of an animal cell. <p> <b>Biolistics (gene gun):</b> In this, cells are bombarded with high velocity micro-particles of gold or tungsten coated with DNA. This method is suitable for plants. </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> 20) (a) What are the three critical research areas of biotechnology? <p> (b) Mention three options that can be thought for increasing food production. </div>
<div class="answer"> <p>β
<b>Answer</b></p> (a) <b>Three critical research areas of biotechnology:</b> <p> (i) Providing the best catalyst in the form of improved organism usually a microbe or pure enzyme. <p> (ii) Creating optimal conditions through engineering for a catalyst to act. <p> (iii) Downstream processing technologies to purify the protein/organic compound. <p> (b) <b>Three options for increasing food production:</b> <p> (i) agrochemical-based agriculture <p> (ii) organic agriculture <p> (iii) genetically engineered crop-based agriculture </div>
<button class="answer-button">View Answer</button>
</div>
<p style="font-size: 30px; font-family: Arial; text-align: center; color: #993d77; background-color: #ffe0f4; padding: 10px;"> <b> PART B: ZOOLOGY </b></p>
<p style="font-size: 18px; font-family: Arial; text-align: left; color: #5c5c5c; background-color: #ebeaec; padding: 10px;"> <b> <i>I. Answer any 3 questions from 1 β 5. Each carries 1 score. (3 x 1 = 3)</i> </b> </p>
<div class="box">
<div class="question">1) Note the relationship between the first pair and complete the second pair. <p> a. Natural selection: Darwin <br> Inheritance of acquired characters: β¦β¦β¦β¦ <p> b. Heart of vertebrates: Homologous organs <br>Flippers of Penguin and Dolphin: β¦β¦β¦β¦β¦β¦. </div>
<div class="answer"><p>β
a. Lamarck b. Analogous organs </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question">2) Choose the odd one from the following and write the common features of others. <p> a. Estrogen b. Androgen <p> c. Relaxin d. Progesterone </div>
<div class="answer"><p>β
b. Androgen. Others are hormones present in female. </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question">3) Identify the diagram and write how it acts. <div class="separator" style="clear: both;"><a href="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEgHKBt3_Z9T2AtgHWwWqi-ykRFHchbT23-zUlUQsy318Qttxlq0gAp4_CP29jWuTDG_4tl1B026Lty4rqvu5PwKDUA_rJLcUjpPKzsle8XtP3sB8f4oyLNWiL5ZP8qDYYPifWBD8NMjVyylO8u2nVMXwZdXq-q92Aqc3jKbrVIbaMVwC3Wto3fqSTvPCBI/s1600/bob.jpg" style="display: block; padding: 1em 0; text-align: center; "><img alt="" border="0" data-original-height="277" data-original-width="190" src="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEgHKBt3_Z9T2AtgHWwWqi-ykRFHchbT23-zUlUQsy318Qttxlq0gAp4_CP29jWuTDG_4tl1B026Lty4rqvu5PwKDUA_rJLcUjpPKzsle8XtP3sB8f4oyLNWiL5ZP8qDYYPifWBD8NMjVyylO8u2nVMXwZdXq-q92Aqc3jKbrVIbaMVwC3Wto3fqSTvPCBI/s1600/bob.jpg"/></a></div></div>
<div class="answer"><p>β
Copper T (CuT). It releases coper ions. </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> 4) Expand the abbreviation UTRs. </div>
<div class="answer"> <p>β
Untranslated Regions. </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question">5) Morphine is extracted from latex of β¦β¦β¦β¦β¦β¦. </div>
<div class="answer"><p>β
<i>Papaver somniferum</i> (poppy plant). </div>
<button class="answer-button">View Answer</button>
</div>
<p style="font-size: 18px; font-family: Arial; text-align: left; color: #5c5c5c; background-color: #ebeaec; padding: 10px;"> <b> <i>II. Answer any 9 questions from 6 β 16. Each carries 2 scores. (9 x 2 = 18)</i> </b> </p>
<div class="box">
<div class="question"> 6) Complete the table using suitable terms. <div class="separator" style="clear: both;"><a href="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEi7iR23415Hvehc0y03vuyd_4GDdnmdunI066FdqYgmfei0LOfUn_pOne9VHKKUFDxiud2YHVSNDe4VEFWSajs9eaCjcZo_gksmo5-poHmUqBPiNrFzLJZc6cviP21nVUaRektpPOEcWaJ_iuf8DYC1iz8pD5tRL1StGukU6f-yc78EV-ja3TFZJ_-7ilk/s1600/bob.jpg" style="display: block; padding: 1em 0; text-align: center; "><img alt="" border="0" data-original-height="138" data-original-width="612" src="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEi7iR23415Hvehc0y03vuyd_4GDdnmdunI066FdqYgmfei0LOfUn_pOne9VHKKUFDxiud2YHVSNDe4VEFWSajs9eaCjcZo_gksmo5-poHmUqBPiNrFzLJZc6cviP21nVUaRektpPOEcWaJ_iuf8DYC1iz8pD5tRL1StGukU6f-yc78EV-ja3TFZJ_-7ilk/s1600/bob.jpg"/></a></div> </div>
<div class="answer"> <p>β
<b>Answer</b></p> (a) 44A+X0 <p> (b) Klinefelterβs syndrome <p> (c) Sterile male/ Gynaecomastia <p> (d) Downβs syndrome </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> 7) In pea plant the gene for yellow seed colour is dominant over green and round seed shape is dominant over wrinkled. Write the four types of gametes formed in a heterozygous pea plant with yellow and round seeds (YyRr). </div>
<div class="answer"> <p>β
YR, Yr, yR and yr. </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> 8) Arrange the following diseases in the following columns in a meaningful order. <div class="separator" style="clear: both;"><a href="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEi_NYUoV2RbC0UAWoqa8IKPSAfVSpf3QR4jrzuJw9PZRAww716cqK7QkM_13ZPaBd3xAKP-IHUgnFZbBuKhWUhlHcDNm-vSJB4FHIBc-zwAM0Uqex_1VXSGBnP8BraG4dCd0k_9H4RUpJnNzziY67wgHxO6PJm8NrXjCExgXdwAoX00DGwfVrV8gcHbtGk/s1600/bob.jpg" style="display: block; padding: 1em 0; text-align: center; "><img alt="" border="0" data-original-height="106" data-original-width="517" src="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEi_NYUoV2RbC0UAWoqa8IKPSAfVSpf3QR4jrzuJw9PZRAww716cqK7QkM_13ZPaBd3xAKP-IHUgnFZbBuKhWUhlHcDNm-vSJB4FHIBc-zwAM0Uqex_1VXSGBnP8BraG4dCd0k_9H4RUpJnNzziY67wgHxO6PJm8NrXjCExgXdwAoX00DGwfVrV8gcHbtGk/s1600/bob.jpg"/></a></div> <center> Typhoid, Ringworms, Amoebiasis, AIDS, Malaria, Pneumonia, Common cold </center> </div>
<div class="answer"> <p>β
<b>Answer</b></p> <div class="separator" style="clear: both;"><a href="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEjgrOzSpcyr6Z38WZO1HTI6Zf60grZqxiwQA1a4qvYoDKQvs9xJIrtM0gqXU-lxQtci4umzQE6yKYJZmVXZkpF_3cLwbq8VoIL0L2fgRP769fBCi9xLUpobAO8Djq1kn9VOsN2OGm5r0IeETYU9ww0QZbLjmuxMKSPzeH_Pxy8OwWEgh6iwAmNKlzVAk9E/s1600/bob2.png" style="display: block; padding: 1em 0; text-align: center; "><img alt="" border="0" data-original-height="114" data-original-width="577" src="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEjgrOzSpcyr6Z38WZO1HTI6Zf60grZqxiwQA1a4qvYoDKQvs9xJIrtM0gqXU-lxQtci4umzQE6yKYJZmVXZkpF_3cLwbq8VoIL0L2fgRP769fBCi9xLUpobAO8Djq1kn9VOsN2OGm5r0IeETYU9ww0QZbLjmuxMKSPzeH_Pxy8OwWEgh6iwAmNKlzVAk9E/s1600/bob2.png"/></a></div> </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> 9) A transcription unit is given below. Observe it and answer the questions. <div class="separator" style="clear: both;"><a href="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEhfHEI0YcZsjCeqfozmMx9SU7IRxUKveHfRvC-jET90Ti4-PHu6EHvuOlbihv15oAjFF19ydgQlSXuKehX-KcdD39G0DM8BLgAwMi2ZzGIn-1cAGKUFLQcIZlN1zLKiXiXOfUCbdL5mGtUJrMfONGRA0OV59xWjg6Jv-2SYnormG7kDj98n-BCoWb7HXX4/s1600/bob.jpg" style="display: block; padding: 1em 0; text-align: center; "><img alt="" border="0" data-original-height="123" data-original-width="450" src="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEhfHEI0YcZsjCeqfozmMx9SU7IRxUKveHfRvC-jET90Ti4-PHu6EHvuOlbihv15oAjFF19ydgQlSXuKehX-KcdD39G0DM8BLgAwMi2ZzGIn-1cAGKUFLQcIZlN1zLKiXiXOfUCbdL5mGtUJrMfONGRA0OV59xWjg6Jv-2SYnormG7kDj98n-BCoWb7HXX4/s1600/bob.jpg"/></a></div> a. How can you identify the coding strand? <p> b. Write the sequence of RNA formed from this unit. </div>
<div class="answer"> <p>β
<b>Answer</b></p> (a) Coding strand would be in 5ββ3β direction. <p> (b) 5β-UCAGUACA-3β
</div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> 10) In a class room discussion, a student argues that allergic reactions are more common in children of metro cities than in villages. <p> a. Do you agree with this statement? <p> b. Which type of immunoglobulin is responsible for allergic reactions? <p> c. Suggest two drugs which reduce allergic symptoms. </div>
<div class="answer"> <p>β
<b>Answer</b></p> (a) Yes. I agree. <p> (b) IgE type. <p> (c) Anti-histamine, adrenaline and steroids. </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> 11) Match the columns B & C with respect to A. <div class="separator" style="clear: both;"><a href="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEiMhqVc_MRukv6C_92_rLfT6zsWeIiGGixWO4Mzwu3zR2fUTBFFZyNxmtm0mBE7SNrenq9iSiW3Ovbi1xWCeqGRLBVKE8pEhtOMRPj18WmfZlGcL_N8VnsGQm0Q7-G4CJiaF3FN9XLfq1HS07qgwlsO9JBKbvG-Ty2YeULTGXJ7g9dL63Z9J7AcM9zuwGw/s1600/bob.jpg" style="display: block; padding: 1em 0; text-align: center; "><img alt="" border="0" data-original-height="175" data-original-width="840" src="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEiMhqVc_MRukv6C_92_rLfT6zsWeIiGGixWO4Mzwu3zR2fUTBFFZyNxmtm0mBE7SNrenq9iSiW3Ovbi1xWCeqGRLBVKE8pEhtOMRPj18WmfZlGcL_N8VnsGQm0Q7-G4CJiaF3FN9XLfq1HS07qgwlsO9JBKbvG-Ty2YeULTGXJ7g9dL63Z9J7AcM9zuwGw/s1600/bob.jpg"/></a></div> </div>
<div class="answer"> <p>β
<b>Answer</b></p> <div class="separator" style="clear: both;"><a href="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEi6XYZTJc-jfuMvTAukNVynArOlHV_zoP8IslGTQ9TXlqB8tRM-NG4sKOTJMJxScIb8qAdHDrN8SH9GjcUdyZ8YUh2FG51-uWtk56AqTaunYomP_-8fhyphenhyphenw0Q9A-ioQ49C-P3dTmv6CdYyZCGhKSE5ZjINFzWTF3x-YmNxpDe2Ayk1Cz76qDhAGlmoZ7tjw/s1600/bob2.png" style="display: block; padding: 1em 0; text-align: center; "><img alt="" border="0" data-original-height="186" data-original-width="741" src="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEi6XYZTJc-jfuMvTAukNVynArOlHV_zoP8IslGTQ9TXlqB8tRM-NG4sKOTJMJxScIb8qAdHDrN8SH9GjcUdyZ8YUh2FG51-uWtk56AqTaunYomP_-8fhyphenhyphenw0Q9A-ioQ49C-P3dTmv6CdYyZCGhKSE5ZjINFzWTF3x-YmNxpDe2Ayk1Cz76qDhAGlmoZ7tjw/s1600/bob2.png"/></a></div> </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> 12) Some stages of the embryonic development are given below. Observe these diagrams and answer the questions. <div class="separator" style="clear: both;"><a href="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEhV6skcClApUILvIZgrurtMOEAuinJSUg_vP9ggIQq4jTQIIfgiT77Fdx9kJ0fjM8ha1LY7cjCLCPO_Pg8QWjd2AqcnHIC4_3PhbWVYhw2Q3Be8BbvU1-vVuRVwYRu5wGwjUKuxDx7l89WasuELWeJo_yqEMg8Y4bLWtcB0q04Vc7acjF33qXfNBUPk0Yk/s1600/bob.jpg" style="display: block; padding: 1em 0; text-align: center; "><img alt="" border="0" data-original-height="185" data-original-width="750" src="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEhV6skcClApUILvIZgrurtMOEAuinJSUg_vP9ggIQq4jTQIIfgiT77Fdx9kJ0fjM8ha1LY7cjCLCPO_Pg8QWjd2AqcnHIC4_3PhbWVYhw2Q3Be8BbvU1-vVuRVwYRu5wGwjUKuxDx7l89WasuELWeJo_yqEMg8Y4bLWtcB0q04Vc7acjF33qXfNBUPk0Yk/s1600/bob.jpg"/></a></div>a. What is A & B? <p> b. Which layer of blastocyst is attached to the endometrium? Name that process. </div>
<div class="answer"> <p>β
<b>Answer</b></p> (a) A= Blastomeres B= Morula <p> (b) Trophoblast. The process is called Implantation. </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> 13) Distinguish between euchromatin and heterochromatin. </div>
<div class="answer"> <p>β
<b>Answer</b></p> β’ <b>Euchromatin:</b> Loosely packed and transcriptionally active region of chromatin. It stains light. <p> β’ <b>Heterochromatin:</b> Densely packed and inactive region of chromatin. It stains dark. </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> 14) (a) State Hardy-Weinberg principle. <p> (b) What is meant by founder effect? </div>
<div class="answer"> <p>β
<b>Answer</b></p> (a) It states that allele frequencies in a population are stable and is constant from generation to generation in the absence of disturbing factors. <p> (b) The gene flow by chance causes change in frequency. Sometimes, the frequency change can lead to evolve into a different species. The original drifted population becomes founders. It is called founder effect. </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> 15) Match the following: <div class="separator" style="clear: both;"><a href="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEgDhpywpcSQTiDqa0fbsbh-wtgwCdMlRoznY66UGu10H8kFHQS6LtQ7ctBOuUEacm5kii_xzFhE7SN8jjmUBr_LO0Hs-Yn_GBvJJZurDwzkzFF8X0LrfSRzm-rl0Wb9XP6SMOLhV3oiNR-40tyC1l0foSU-y355aUNK5PiN0lrKv4WB9EJ9RxbiliWxGtY/s1600/bob.jpg" style="display: block; padding: 1em 0; text-align: center; "><img alt="" border="0" data-original-height="178" data-original-width="522" src="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEgDhpywpcSQTiDqa0fbsbh-wtgwCdMlRoznY66UGu10H8kFHQS6LtQ7ctBOuUEacm5kii_xzFhE7SN8jjmUBr_LO0Hs-Yn_GBvJJZurDwzkzFF8X0LrfSRzm-rl0Wb9XP6SMOLhV3oiNR-40tyC1l0foSU-y355aUNK5PiN0lrKv4WB9EJ9RxbiliWxGtY/s1600/bob.jpg"/></a></div> </div>
<div class="answer"> <p>β
<b>Answer</b></p> <div class="separator" style="clear: both;"><a href="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEh5T1G1rfMuC3DB3t8YWT5tZDwiWhnTs0xBQTwTrHc1t4nMwPf5ylPK8Ob4Hp68K-EUg1LK4ypqL7Y8iw_CzThNxKhI4Or_FYtYM1NDqX2V5upA5jgFHPlKntMlRkQgadPWyZk_NmoOKq3jRe8H8lMRtWQGqoI1AnXFBymXm3y-NUkK6GDmJm6fBt_YQ2s/s1600/bob2.png" style="display: block; padding: 1em 0; text-align: center; "><img alt="" border="0" data-original-height="174" data-original-width="427" src="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEh5T1G1rfMuC3DB3t8YWT5tZDwiWhnTs0xBQTwTrHc1t4nMwPf5ylPK8Ob4Hp68K-EUg1LK4ypqL7Y8iw_CzThNxKhI4Or_FYtYM1NDqX2V5upA5jgFHPlKntMlRkQgadPWyZk_NmoOKq3jRe8H8lMRtWQGqoI1AnXFBymXm3y-NUkK6GDmJm6fBt_YQ2s/s1600/bob2.png"/></a></div> </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> 16) A collection of peppered moths made in England during different period is given below. <div class="separator" style="clear: both;"><a href="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEhtzF4pYmjHav-jVkWvdfEuOVYhwn2SGy-kLOHr6kD0vtBITpinWBFpHGV45cYKrRALKTzh96mwASwf5QCcfdg6D38RBSc39cLSmCazM7-GjGvZ8m71HETytFrCDplhlTlhsxY0rGE6GUOG3wRa7r4GrKHM1Q17_F6TGPMd_H8vW6mN4LwKFJy1jFk3nB8/s1600/bob.jpg" style="display: block; padding: 1em 0; text-align: center; "><img alt="" border="0" data-original-height="144" data-original-width="553" src="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEhtzF4pYmjHav-jVkWvdfEuOVYhwn2SGy-kLOHr6kD0vtBITpinWBFpHGV45cYKrRALKTzh96mwASwf5QCcfdg6D38RBSc39cLSmCazM7-GjGvZ8m71HETytFrCDplhlTlhsxY0rGE6GUOG3wRa7r4GrKHM1Q17_F6TGPMd_H8vW6mN4LwKFJy1jFk3nB8/s1600/bob.jpg"/></a></div> a. What is your observation? <p> b. Name the evolutionary process behind this phenomenon. <p> c. Write the reason for decreased number of white winged moth in 1920. </div>
<div class="answer"> <p>β
<b>Answer</b></p> (a) It denotes the variations in the number of white winged moths and dark winged moths in different periods. <p> (b) Natural selection. <p> (c) After industrialization (1920), the tree trunks became dark due to industrial smoke and soot. No growth of lichens. So white winged moths did not survive because the predators identified them easily. Dark winged moth survived because of suitable dark background. </div>
<button class="answer-button">View Answer</button>
</div>
<p style="font-size: 18px; font-family: Arial; text-align: left; color: #5c5c5c; background-color: #ebeaec; padding: 10px;"> <b> <i>III. Answer any 3 questions from 17 β 20. Each carries 3 scores. (3 x 3 = 9)</i> </b> </p>
<div class="box">
<div class="question"> 17) The first child of a couple is affected with phenylketonuria. During the second pregnancy they visited a genetic counsellor and he prepared a pedigree chart of their family. <p> a. What is pedigree analysis? <p> b. Draw the symbols for <p> i. Normal male <p> ii. Affected female <p> iii. Sex unspecified <p> iv. Consanguineous mating </div>
<div class="answer"> <p>β
<b>Answer</b></p> (a) An analysis of genetic traits in several generations of a family is called pedigree analysis. <p> (b) <div class="separator" style="clear: both;"><a href="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEg7N3Bz8thdWSjp5FXuVw18AbY9I5TQwGj_KxEM8srdumSZ6jKyKWoQq4m3USA3MMPVz-5u8rWtG-_XPjPPKwjA-ABqoFc-j7rjpSW2WQJmP92f5ZOXlAt0361G8MccxaSXwkEL6STMVTZDeGRMU2y43CG2YXyO4qZy8YjJi8NS9kB6nZNmmXwhnI2w5N8/s1600/bob2.png" style="display: block; padding: 1em 0; text-align: center; "><img alt="" border="0" data-original-height="124" data-original-width="415" src="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEg7N3Bz8thdWSjp5FXuVw18AbY9I5TQwGj_KxEM8srdumSZ6jKyKWoQq4m3USA3MMPVz-5u8rWtG-_XPjPPKwjA-ABqoFc-j7rjpSW2WQJmP92f5ZOXlAt0361G8MccxaSXwkEL6STMVTZDeGRMU2y43CG2YXyO4qZy8YjJi8NS9kB6nZNmmXwhnI2w5N8/s1600/bob2.png"/></a></div>
</div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> 18) In <i>E. coli</i>, lactose catabolism is controlled by <i>Lac</i> operon. <i>Lac</i> operon in the absence of inducer (lactose) is given. <div class="separator" style="clear: both;"><a href="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEjdg9fQs9mv9pBvnILh5eb0A6PiAu1yOt03DQ9ACBCZMO5l74vudBXAwRligdLelZqVGzr6jkkhweB3DJnkt6Vr0g_pvfSgaUCzbJESbmr5najQ5Ismz99FA33fSkWwsTi_hwu92HQ7RGjEXS9rJ918-K6vwxM-KCsCqdXiDM0XU7TEpOfWXCcxVvAbDS0/s1600/bob.jpg" style="display: block; padding: 1em 0; text-align: center; "><img alt="" border="0" data-original-height="285" data-original-width="584" src="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEjdg9fQs9mv9pBvnILh5eb0A6PiAu1yOt03DQ9ACBCZMO5l74vudBXAwRligdLelZqVGzr6jkkhweB3DJnkt6Vr0g_pvfSgaUCzbJESbmr5najQ5Ismz99FA33fSkWwsTi_hwu92HQ7RGjEXS9rJ918-K6vwxM-KCsCqdXiDM0XU7TEpOfWXCcxVvAbDS0/s1600/bob.jpg"/></a></div> a. What is βPβ? <p> b. Name the enzymes produced by the structural genes βZβ, βYβ and βaβ. <p> c. Redraw the diagram in the presence of an inducer. </div>
<div class="answer"> <p>β
<b>Answer</b></p> (a) Promoter. <p> (b) z gene: <i>κ΅-galactosidase</i>, <p> y gene: <i>permease</i> <p> a gene: <i>transacetylase</i> <p> (c) <div class="separator" style="clear: both;"><a href="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEipvhqGAYnPz7q6bG93rWnnNIXpyEBUpv7I5U9pUhYUNtABxC0zmmltYIq_eAOpQfLgZxkCoDd4Rm-4DewvB0-jLLF40z0lfCoAelO-OpKeEzUSSSyvSFS2_nN2NTDgbK-nFYps9HiU71B5DENIEjIvarqq_NfVIQHfelG2bedsZHqhrzTQQpKjLMWrKC0/s1600/bob2.png" style="display: block; padding: 1em 0; text-align: center; "><img alt="" border="0" data-original-height="512" data-original-width="1095" src="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEipvhqGAYnPz7q6bG93rWnnNIXpyEBUpv7I5U9pUhYUNtABxC0zmmltYIq_eAOpQfLgZxkCoDd4Rm-4DewvB0-jLLF40z0lfCoAelO-OpKeEzUSSSyvSFS2_nN2NTDgbK-nFYps9HiU71B5DENIEjIvarqq_NfVIQHfelG2bedsZHqhrzTQQpKjLMWrKC0/s1600/bob2.png"/></a></div>
</div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> 19) βSTIs present a major health concern in both industrialized and developing countries.β <p> a. What do you mean by STIs? <p> b. Name two STIs. <p> c. Suggest two preventive measures. </div>
<div class="answer"> <p>β
<b>Answer</b></p> (a) Diseases or infections transmitted through sexual intercourse are called Sexually transmitted infections/ diseases (STDs or STIs). <p> (b) Gonorrhoea, syphilis, hepatitis-B, genital herpes etc. <p> (c) β’ Avoid sex with unknown partners/multiple partners. <p> β’ Always use condoms during coitus. </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> 20) The given graph shows the distribution of insects in different latitudes of earth. <div class="separator" style="clear: both;"><a href="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEiiTUlQ8nugDoH0Tug9CgtiAWAOihVa_5K5ByVQdMF9SZD1zb02GX74AQlnsAOuUdSygs1N5gjI6X03Ygfga3-Lcx0eT_edFlHZiUz2ZAkOnxF2OeIemsJBF1w0JRcgAjQrXOan34rB6xEYMR1H7XRB_qwXHLEOAo9ABtENh9B1VGbz5XyeykIsxFdKcCo/s1600/bob.jpg" style="display: block; padding: 1em 0; text-align: center; "><img alt="" border="0" data-original-height="215" data-original-width="374" src="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEiiTUlQ8nugDoH0Tug9CgtiAWAOihVa_5K5ByVQdMF9SZD1zb02GX74AQlnsAOuUdSygs1N5gjI6X03Ygfga3-Lcx0eT_edFlHZiUz2ZAkOnxF2OeIemsJBF1w0JRcgAjQrXOan34rB6xEYMR1H7XRB_qwXHLEOAo9ABtENh9B1VGbz5XyeykIsxFdKcCo/s1600/bob.jpg"/></a></div> a. What is your observation? <p> b. List the three reasons for greater biodiversity in tropical regions. <p> c. Write two causes of biodiversity losses. </div>
<div class="answer"> <p>β
<b>Answer</b></p> (a) Insect species diversity decreases from the equator to the poles. <p> (b) Biodiversity (species richness) is highest in tropics because <p> β’ Tropics had more evolutionary time. <p> β’ Relatively constant environment (less seasonal). <p> β’ They receive more solar energy which contributes to greater productivity. <p> (c) (i) Habitat loss and fragmentation (ii) Overexploitation </div>
<button class="answer-button">View Answer</button>
</div>
<script>
// Get all the answer buttons
const answerButtons = document.querySelectorAll('.answer-button');
// Add a click event listener to each answer button
answerButtons.forEach(button => {
button.addEventListener('click', () => {
// Get the answer section for this button
const answerSection = button.previousElementSibling;
// Toggle the answer section's visibility
answerSection.classList.toggle('visible');
// Change the button text to "Hide Answer" or "View Answer"
if (answerSection.classList.contains('visible')) {
button.textContent = 'Hide Answer';
button.classList.add('hide-answer');
} else {
button.textContent = 'View Answer';
button.classList.remove('hide-answer');
}
});
});
</script>
<html>
<head>
<style>
.special-paragraph {
margin-bottom: -10px; /* Adjust this value to reduce the space */
color: #333333;
font-family: Arial, sans-serif;
font-size: 23px;
font-weight: bold;
line-height: 1.5;
padding: 7px;
text-align: center;
border-radius: 10px;
}
.green-bg {
background-color: #ddffd9; /* Green background */
}
.blue-bg {
background-color: #b0eaff; /* Blue background */
}
</style>
</head>
<body>
<p class="special-paragraph green-bg">
<a href="https://www.bankofbiology.com/2020/10/hse-1-2-model-qp-online-exam-series.html" style="color: green;"> π Other Question Papers </a>
</p>
<p class="special-paragraph blue-bg">
<a href="https://www.bankofbiology.com/p/question-bank.html" style="color: blue;"> π Exam Special Materials </a>
</p>
</body>
</html>
<div class="blogger-post-footer"><p> Β© copyright 2024 β All rights reserved </p>
<a href=βhttps://www.bankofbiology.comβ>bankofbiology.com</a></div>Abu Raniyahttp://www.blogger.com/profile/14189496606355139812noreply@blogger.com0tag:blogger.com,1999:blog-6823671394482492613.post-26471275338921099852024-03-08T07:41:00.003+05:302024-03-17T11:27:35.550+05:30Exam Capsule Slides PPT and PDF | Sexual Reproduction in Flowering Plants | Class 12<h1 style="text-align: center;">
<span style="color: #cc0000;">Exam Capsule PPT </span><br /><span
style="color: #0b5394;"
>Sexual Reproduction in Flowering Plants</span
>
</h1>
<iframe src="https://docs.google.com/presentation/d/e/2PACX-1vSdgbfOcIz9-5k9YNHTv3pJdv99_ZvhLDWcU2D6npt-t-yzwwDBanMBESJbBonsbw/embed?start=true&loop=false&delayms=5000" frameborder="0" width="100%" height="400" allowfullscreen="true" mozallowfullscreen="true" webkitallowfullscreen="true"></iframe>
<h1 style="text-align: center;">π <a href="https://docs.google.com/presentation/d/1CqvTtHqx1Y4v2hSE1fOX_ez9f82a3erP/edit?usp=sharing&ouid=103337463072223242758&rtpof=true&sd=true" target="_blank">Download PPT version</a></h1>
<div><h1 style="text-align: center;">π <a href="https://drive.google.com/file/d/1D0A2EQSO4CqzkigY2yV1RvrCnbxZGo5y/view?usp=drive_link" target="_blank">Download PDF version</a></h1></div>
<div><br /></div>
<div class="blogger-post-footer"><p> Β© copyright 2024 β All rights reserved </p>
<a href=βhttps://www.bankofbiology.comβ>bankofbiology.com</a></div>Abu Raniyahttp://www.blogger.com/profile/14189496606355139812noreply@blogger.com2tag:blogger.com,1999:blog-6823671394482492613.post-5381952635978886192024-03-06T19:05:00.034+05:302024-03-09T10:07:39.131+05:30Plus Two Biology (Bot + Zoo) | Practice Model Question Paper PDF with Answer key | SET 4<!DOCTYPE html>
<html>
<head>
<title>Example Webpage</title>
<style>
body {
user-select: none; /* Prevent selection of text */
-moz-user-select: none; /* Firefox */
-webkit-user-select: none; /* Safari and Chrome */
-ms-user-select: none; /* Internet Explorer/Edge */
}
h1 {
user-select: text; /* Allow selection of title */
}
</style>
</head>
<p style="font-size: 25px; font-family: Arial; text-align: center; color: #2068d4; line-height: 1.5;"> <b> π <a href="https://drive.google.com/file/d/1CpXpfOlroxvhG9u0XvqwcEKc1HAwdnLk/view?usp=sharing" target="_blank">Download Biology Question Paper PDF - SET 4</a> </b> </p>
<p style="font-size: 30px; font-family: Arial; text-align: center; color: #0c8a7d; background-color: #a2f5d3; padding: 10px;"> <b> PART A: BOTANY </b></p>
<style>
/* Customize the box style */
.box {
background-color: #ffffff;
border: 1px solid #ffffff;
border-radius: 1px;
padding: 10px;
margin-bottom: 10px;
margin-right: -14px;
margin-left: -14px;
}
/* Customize the question style */
.question {
font-size: 17px;
font-weight: bold;
color: #3D4849;
font-family: Open Sans;
margin-bottom: 10px;
}
/* Customize the answer style */
.answer {
font-size: 18px;
font-weight: normal;
font-family: Roboto;
margin-bottom: 10px;
background-color: #e7ffde;
}
/* Hide the answer by default */
.answer {
display: none;
}
/* Customize the view/hide answer button */
.answer-button {
background-color: #4CAF50;
border: none;
border-radius: 5px;
color: white;
padding: 8px 16px;
text-align: center;
text-decoration: none;
display: inline-block;
font-size: 18px;
margin-bottom: 1px;
cursor: pointer;
}
/* Style the button differently when it changes to "Hide Answer" */
.answer-button.hide-answer {
background-color: #f44336;
}
/* Show the answer when the visible class is added */
.answer.visible {
display: block;
}
.table-text {
display: grid;
grid-template-columns: 50% 50%;
grid-gap: none;
margin-top: 5px;
border-collapse: collapse;
}
.table-text-2 {
display: grid;
grid-template-columns: 33.33% 33.33% 33.33%;
grid-gap: none;
margin-top: 5px;
border-collapse: collapse;
}
.table-text-header,
.table-text-cell {
padding: 5px;
border: 1px solid black;
text-align: left;
}
.table-text-header {
font-weight: bold;
text-align: center;
}
.no-break {
white-space: nowrap;
}
.tab {
text-indent: 40px; /* Adjust the value as per your preference */
}
</style>
<p style="font-size: 18px; font-family: Arial; text-align: left; color: #5c5c5c; background-color: #ebeaec; padding: 10px;"> <b> <i>I. Answer any 3 questions from 1 β 5. Each carries 1 score. (3 x 1 = 3)</i> </b> </p>
<div class="box">
<div class="question">1) Fill up the blanks with appropriate terms in the given pyramid of trophic level: <div class="separator" style="clear: both;"><a href="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEhfCotEYWBICZF8Yn1BKHnMbaJIYNztOV39ywKYd_X2fyjcX3bCD-Iss-dwEuuPV4BoETtHsDuXwN5_QJEybLHKnNTEJe8qUICmzSyzHoMN4bPGTX7fu7r606sjnc1jQ4RaFWcrpfDeWJ0qeKI3G6xtlGvL9HGUQK1cX9rWtgwsZsGVxQ55IXXvASXvwwc/s1600/bob.jpg" style="display: block; padding: 1em 0; text-align: center; "><img alt="" border="0" data-original-height="145" data-original-width="405" src="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEhfCotEYWBICZF8Yn1BKHnMbaJIYNztOV39ywKYd_X2fyjcX3bCD-Iss-dwEuuPV4BoETtHsDuXwN5_QJEybLHKnNTEJe8qUICmzSyzHoMN4bPGTX7fu7r606sjnc1jQ4RaFWcrpfDeWJ0qeKI3G6xtlGvL9HGUQK1cX9rWtgwsZsGVxQ55IXXvASXvwwc/s1600/bob.jpg"/></a></div></div>
<div class="answer"><p>β
a. Primar consumer <p> b. Secondary consumer </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question">2) Observe the relation in the first pair and fill up the blank in the second. <p> Cry I Ac: Control cotton bollworm <p> β¦β¦β¦β¦β¦β¦.: Control corn borer </div>
<div class="answer"><p>β
cryIAb </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question">3) Fill up the blanks after reading the statement: <p> The post fertilization events in angiosperms. <p> Zygote : Embryo <p> Ovule : β¦β¦β¦β¦β¦β¦ <p> Ovary : β¦β¦β¦β¦β¦β¦ </div>
<div class="answer"><p>β
Ovule: Seed Ovary: Fruit </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> 4) Sucker fish and shark live in close association is a classic example of β¦β¦β¦β¦β¦β¦. </div>
<div class="answer"> <p>β
Commensalism </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question">5) In PCR, repeated amplification is achieved by the use of a thermostable DNA polymerase isolated from a bacterium called ..................... </div>
<div class="answer"><p>β
<i>Thermus aquaticus</i> </div>
<button class="answer-button">View Answer</button>
</div>
<p style="font-size: 18px; font-family: Arial; text-align: left; color: #5c5c5c; background-color: #ebeaec; padding: 10px;"> <b> <i>II. Answer any 9 questions from 6 β 16. Each carries 2 scores. (9 x 2 = 18)</i> </b> </p>
<div class="box">
<div class="question"> 6) Population interactions: <div class="separator" style="clear: both;"><a href="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEiFUmJQacb324eN1XOq2tHtpx9RDQKJRn8kkONiXLqYn98zEyg5_QI_H7PcAciaQuL-ITZUa_3d3fYoIcI5GcaVkZCDA6dGPX0S8xabQF2pxhg28aSEZnsOsP3QyXz3GqzsBG839Nxc55U18KH2jfedSv4GsUsycpTHYP9z4KqXVXanom_UhwapZWtYnY4/s1600/bob.jpg" style="display: block; padding: 1em 0; text-align: center; "><img alt="" border="0" data-original-height="142" data-original-width="529" src="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEiFUmJQacb324eN1XOq2tHtpx9RDQKJRn8kkONiXLqYn98zEyg5_QI_H7PcAciaQuL-ITZUa_3d3fYoIcI5GcaVkZCDA6dGPX0S8xabQF2pxhg28aSEZnsOsP3QyXz3GqzsBG839Nxc55U18KH2jfedSv4GsUsycpTHYP9z4KqXVXanom_UhwapZWtYnY4/s1600/bob.jpg"/></a></div>Where '+' beneficial interaction <br> '-' detrimental interaction <br> '0' neutral interaction <p> Observe the interactions of populations of 3 species as shown in the table. Name the interactions between: <p> a. Species x and species y in case 1 <p> b. Species y and species z in case 2 <p> c. Species x and species z in case 3 <p> d. Species y and species z in case 1 </div>
<div class="answer"> <p>β
<b>Answer</b></p> <b>Population interactions: </b> <p> a. Mutualism <p> b. Parasitism/Predation <p> c. Competition <p> d. Commensalism </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> 7) Pre-fertilization events of sexual reproduction in all organisms are gametogenesis and gamete transfer. What are the post fertilization events? </div>
<div class="answer"> <p>β
<b>Answer</b></p> Post-fertilization events in sexual reproduction include: <p> β’ <b>Endosperm development: </b> Primary endosperm cell divides repeatedly to form a triploid endosperm tissue. <p> β’ <b>Embryogeny:</b> The zygote develops into an embryo. <p> β’ <b>Seed and Fruit formation:</b> The ovules develop into seeds and the ovary develops into a fruit. </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> 8) Observe the sketch of stirred-tank bioreactor and label the parts A, B, C and D. <div class="separator" style="clear: both;"><a href="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEjjclZFExpk_X8q7AM7Fqutu8IpaBClseVHhVIIqCiAeQZhcaBw2l_EXi-UpoyNLLxX4YmzxJwAMAmF9ch5WrLIyKjJKLNOIdZCXzQnXutT-Wusxj_cJf7vSf3uYGd1HFdOq6_suPA5aUi2MwEoz-gy02Rf3a9eq46jYU1SK3nyqvFosbrMV94UCkTlrzE/s1600/bob.jpg" style="display: block; padding: 1em 0; text-align: center; "><img alt="" border="0" data-original-height="424" data-original-width="277" src="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEjjclZFExpk_X8q7AM7Fqutu8IpaBClseVHhVIIqCiAeQZhcaBw2l_EXi-UpoyNLLxX4YmzxJwAMAmF9ch5WrLIyKjJKLNOIdZCXzQnXutT-Wusxj_cJf7vSf3uYGd1HFdOq6_suPA5aUi2MwEoz-gy02Rf3a9eq46jYU1SK3nyqvFosbrMV94UCkTlrzE/s1600/bob.jpg"/></a></div></div>
<div class="answer"> <p>β
<b>Answer</b></p> A= Motor <p> B= Foam braker <p> C= Flat bladed impeller <p> D= Culture broth. </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> 9) Briefly explain Somatic hybridisation. </div>
<div class="answer"> <p>β
<b>Answer</b></p> Somatic hybridization is the fusion of protoplasts from two different varieties of plants with desirable characters to get hybrid protoplasts. It is grown to form a new plant called somatic hybrids. <p> Protoplasts can be isolated after digesting the cell walls of plant cells. <p> E.g. Tomato protoplast + Potato protoplast β pomato. </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> 10) Emasculation and Bagging are two steps of a crop improvement program called Artificial hybridisation. Explain them. </div>
<div class="answer"> <p>β
<b>Answer</b></p> Emasculation and Bagging. <p> β’ <b>Emasculation:</b> Removal of anthers from the bisexual flower bud of female parent before the anther dehisces. <p> β’ <b>Bagging:</b> Here, emasculated flowers are covered with a bag to prevent contamination of its stigma with unwanted pollen. </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> 11) Observe the cloning vector and explain the following: <p> a. <i>ori</i> b. <i>rop</i> <div class="separator" style="clear: both;"><a href="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEg8i5AoW5wVFxFfUdcU812B9ZQLXOLraUZy7qy5qABcCOSYhFDY-QwnRJdC62rL1R9PtQ2gaLpSz7mWRWsuhoyTJ2w2R1IUB0TFHeey554lRdyjVPN_R1ij9Lo7AB3plKdDgG4Ydo1wMebVguR1vxrOFPmQCOv4uu0CPW2EQ5_zTu2w5mRPDjR_GZKtRFs/s1600/bob.jpg" style="display: block; padding: 1em 0; text-align: center; "><img alt="" border="0" data-original-height="385" data-original-width="460" src="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEg8i5AoW5wVFxFfUdcU812B9ZQLXOLraUZy7qy5qABcCOSYhFDY-QwnRJdC62rL1R9PtQ2gaLpSz7mWRWsuhoyTJ2w2R1IUB0TFHeey554lRdyjVPN_R1ij9Lo7AB3plKdDgG4Ydo1wMebVguR1vxrOFPmQCOv4uu0CPW2EQ5_zTu2w5mRPDjR_GZKtRFs/s1600/bob.jpg"/></a></div></div>
<div class="answer"> <p>β
<b>Answer</b></p> a) <b>Ori (Origin of Replication)</b> is a specific sequence in the DNA where replication begins. Any piece of DNA linked to this sequence can replicate within host cells. <p> b) <b>rop:</b> Codes for the proteins involved in the replication of plasmid. </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> 12) Biotechnology has important application in the field of Molecular Diagnosis. Justify with two examples. </div>
<div class="answer"> <p>β
<b>Answer</b></p> Yes. Biotechnology has important application in the field of Molecular Diagnosis. For example, <p> a. <b>Polymerase Chain Reaction (PCR):</b> It is used to detect HIV in suspected patients, gene mutations in suspected cancer patients etc. <p> b. <b>ELISA (Enzyme Linked Immuno-Sorbent Assay):</b> It is used to detect infection by pathogen or the antibodies synthesized against the pathogen. </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> 13) a) Define Verhulst-Pearl Logistic Growth. <p> b) Write the equation to describe this. </div>
<div class="answer"> <p>β
<b>Answer</b></p> a) A population with limited resources shows initially a lag phase, phases of acceleration & deceleration and finally an asymptote. This type of population growth is called Verhulst-Pearl Logistic Growth. <p> b) <div class="separator" style="clear: both;"><a href="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEjaeOnkKsh-QJZVwKP4lOMzC-NUVAag67LEtwWCl_SaNdx0vaMRzWdYFUVm1aiVofSfRf_iBCL2E5zA2BKrAlEQqBtpl-L0adqGXfS87Txsh5ggmut8CxI62UqEhVHFz2DOj7ej2quWofJ3abU9rPmprLnNvu6nUTDOlkOIzscALaZgQTCOzQNPn6G-AZk/s1600/bob.jpg" style="display: block; padding: 1em 0; text-align: center; "><img alt="" border="0" data-original-height="76" data-original-width="256" src="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEjaeOnkKsh-QJZVwKP4lOMzC-NUVAag67LEtwWCl_SaNdx0vaMRzWdYFUVm1aiVofSfRf_iBCL2E5zA2BKrAlEQqBtpl-L0adqGXfS87Txsh5ggmut8CxI62UqEhVHFz2DOj7ej2quWofJ3abU9rPmprLnNvu6nUTDOlkOIzscALaZgQTCOzQNPn6G-AZk/s1600/bob.jpg"/></a></div>
</div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> 14) What is meant by competition in population interaction? Give one example. </div>
<div class="answer"> <p>β
<b>Answer</b></p> It is a process in which fitness of one species (r value) is significantly lower in presence of another species. Here, both species are harmed (-). <p> E.g., Flamingoes & fishes in some shallow South American lakes compete for zooplankton. </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> 15) Define the terms: <p>(a) Trophic level <p> (b) Food web. </div>
<div class="answer"> <p>β
<b>Answer</b></p> (a) <b>Trophic Level:</b> It refers to the position an organism in a food chain. <p> (b) <b>Food Web:</b> It is a complex network of interconnecting food chains that shows the feeding relationships. </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> 16) Briefly explain the processes fragmentation and leaching. </div>
<div class="answer"> <p>β
<b>Answer</b></p> <b>Fragmentation:</b> It is the breakdown of detritus into smaller particles by detritivores (e.g. earthworm). <p> <b>Leaching:</b> It is the process in which water soluble inorganic nutrients go down into soil horizon and precipitate as unavailable salts. </div>
<button class="answer-button">View Answer</button>
</div>
<p style="font-size: 18px; font-family: Arial; text-align: left; color: #5c5c5c; background-color: #ebeaec; padding: 10px;"> <b> <i>III. Answer any 3 questions from 17 β 20. Each carries 3 scores. (3 x 3 = 9)</i> </b> </p>
<div class="box">
<div class="question"> 17) Plus Two students of a school on their study tour collected flowers showing the following character: <p> 1) Flowers are with light pollen grains <p> 2) Colourful flowers <p> 3) Nectar producing flowers <p> 4) Flowers with feathery stigma <p> a. Arrange the characters under different pollination groups in the given table. <p> b. Write the name of 2 flowers pollinating through water. <div class="separator" style="clear: both;"><a href="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEg4K-eFQ-gWdiHGwzRtoqRiPKPE82usavQnytJugmQfClhW-cBVSTQsi2P_Yuxfq0WFASQq1xLjz5kxICavYirracSfi9otmVYoziV7dm6apOThMFfrIa0v4lZQLoxpd1Ya-f8_nJbdsWmZSJ8aOVZLaVePeT14thWmz5sU4csl7w7YNEUC9Nrjw7eLWz4/s1600/bob.jpg" style="display: block; padding: 1em 0; text-align: center; "><img alt="" border="0" data-original-height="151" data-original-width="604" src="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEg4K-eFQ-gWdiHGwzRtoqRiPKPE82usavQnytJugmQfClhW-cBVSTQsi2P_Yuxfq0WFASQq1xLjz5kxICavYirracSfi9otmVYoziV7dm6apOThMFfrIa0v4lZQLoxpd1Ya-f8_nJbdsWmZSJ8aOVZLaVePeT14thWmz5sU4csl7w7YNEUC9Nrjw7eLWz4/s1600/bob.jpg"/></a></div>
</div>
<div class="answer"> <p>β
<b>Answer</b></p> a. Pollination groups. <div class="separator" style="clear: both;"><a href="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEhDkQrN-jms8BJhvpEr0CjWc1lJjNfTQAv0-I3U-kqFFtWpGE-kiua1pD5Z_xebWKabG_XnTuEkDcyKkkGNAcmEy74ywLK8Im998y8SBToNh01FnupWspgPTZcuAM39rk3tpWmVTSaE_nm3CxFpZaQLoZqgc4-1aFmhCMjeldErGXeD590Ewf5eOKQ4x3E/s1600/bob2.png" style="display: block; padding: 1em 0; text-align: center; "><img alt="" border="0" data-original-height="174" data-original-width="766" src="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEhDkQrN-jms8BJhvpEr0CjWc1lJjNfTQAv0-I3U-kqFFtWpGE-kiua1pD5Z_xebWKabG_XnTuEkDcyKkkGNAcmEy74ywLK8Im998y8SBToNh01FnupWspgPTZcuAM39rk3tpWmVTSaE_nm3CxFpZaQLoZqgc4-1aFmhCMjeldErGXeD590Ewf5eOKQ4x3E/s1600/bob2.png"/></a></div> b. <i>Vallisneria</i> & <i>Hydrilla</i>. </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> 18) a) Mention any two features that are required to facilitate cloning into a vector. <p> b) Since DNA is a hydrophilic molecule, it cannot pass through cell membranes. So bacterial cells are made βcompetentβ to take up alien DNA or plasmid. Prepare a flowchart showing the steps of this process. </div>
<div class="answer"> <p>β
<b>Answer</b></p> a) Origin of Replication (Ori), Selectable Marker, Cloning Sites etc. <p> b) Treat bacterial cells with a specific concentration of a divalent cation (e.g. calcium) β DNA enters the bacterium through pores in cell wall β Incubate the cells with recombinant DNA on ice β Place them briefly at 42Β°C (heat shock) β Put them back on ice β Bacteria take up recombinant DNA. </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> 19) (a) Rani wrote name of the following organisms in her notebook. Arrange the terms in a food chain sequence. <p> <center> Man, hen, earthworm, mango-tree </center> <p> (b) Explain food chain and name the types of food chain. </div>
<div class="answer"> <p>β
<b>Answer</b></p> (a) Mango-tree β Earthworm β Hen β Man. <p> (b) The chain of feeding relationship between different organisms is called a food chain. It is 2 types: <p> β’ <b>Grazing Food Chain (GFC):</b> Here, primary consumer feeds on living plants (producer). <p> β’ <b>Detritus Food Chain (DFC):</b> Here, primary consumer feeds on dead organic matter (detritus). </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> 20) Match the following: <div class="separator" style="clear: both;"><a href="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEizC1zA6Qvq4QU4wsoGpKHnqtPhgPgneRlHpUYhIi9bAN0iaoKE-hwm1JXtyHxSIzLclu5gc3xS2sckfnF-7yTzyipK_WHH5RiMxz6ss1GroaOWSr4IR4pch14ZDiNlZJYTY1_5XnnhcmwpMCnjwoBhaQxJSngTb2JooLsgYoNQ5uVr92AsSYDSLJXBrBk/s1600/bob.jpg" style="display: block; padding: 1em 0; text-align: center; "><img alt="" border="0" data-original-height="241" data-original-width="676" src="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEizC1zA6Qvq4QU4wsoGpKHnqtPhgPgneRlHpUYhIi9bAN0iaoKE-hwm1JXtyHxSIzLclu5gc3xS2sckfnF-7yTzyipK_WHH5RiMxz6ss1GroaOWSr4IR4pch14ZDiNlZJYTY1_5XnnhcmwpMCnjwoBhaQxJSngTb2JooLsgYoNQ5uVr92AsSYDSLJXBrBk/s1600/bob.jpg"/></a></div></div>
<div class="answer"> <p>β
<b>Answer</b></p> <div class="separator" style="clear: both;"><a href="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEiqfy-FNB08U9kM4gLvmbVLvSCOm1tD_gIz8KyNEhCZ1mctpk6uiY11GJLo6LgIkczSMOorpdjckqLvrWLU1wnyl0pvCgfQV_Fqf5lWosnC571wAPTdA95PmzxBK_D7ySVvz0VWmZ_8Haq_lMZ0zr8E-KEgT9bVOcb155XFHi8XpE8WAzKHjKtpj0YHulk/s1600/bob2.png" style="display: block; padding: 1em 0; text-align: center; "><img alt="" border="0" data-original-height="265" data-original-width="633" src="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEiqfy-FNB08U9kM4gLvmbVLvSCOm1tD_gIz8KyNEhCZ1mctpk6uiY11GJLo6LgIkczSMOorpdjckqLvrWLU1wnyl0pvCgfQV_Fqf5lWosnC571wAPTdA95PmzxBK_D7ySVvz0VWmZ_8Haq_lMZ0zr8E-KEgT9bVOcb155XFHi8XpE8WAzKHjKtpj0YHulk/s1600/bob2.png"/></a></div> </div>
<button class="answer-button">View Answer</button>
</div>
<p style="font-size: 30px; font-family: Arial; text-align: center; color: #993d77; background-color: #ffe0f4; padding: 10px;"> <b> PART B: ZOOLOGY </b></p>
<p style="font-size: 18px; font-family: Arial; text-align: left; color: #5c5c5c; background-color: #ebeaec; padding: 10px;"> <b> <i>I. Answer any 3 questions from 1 β 5. Each carries 1 score. (3 x 1 = 3)</i> </b> </p>
<div class="box">
<div class="question">1) Note the relationship between first two terms and suggest a suitable term for the fourth place. <p> a. Sperm: Seminiferous tubules Ovum: β¦β¦β¦β¦β¦ <p> b. Progesterone: Corpus luteum HCG: β¦β¦β¦β¦β¦
</div>
<div class="answer"><p>β
a. Ovarian follicles b. Placenta </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question">2) Given are two unlabelled diagrams depicting invertebrate and vertebrate diversity. What do A and B stand for? <div class="separator" style="clear: both;"><a href="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEhR37vjIZI0DR5vzrYuHD5TRQnJTq35SuLnjJ8DPyxZBMnlmS532ir_8M9_1z2FGQyV_DajMAJRaq8FUPPkVtGZ3nKSlfEvEXtfvFxwr0qwvgUERMcUsawwULKuuK2A1pRSviV5uHtDDWulKlfNCb5aN4oeZbLt3CXkApayYg6uMzxE0bd2VhTl8mRaVO0/s1600/bob.jpg" style="display: block; padding: 1em 0; text-align: center; "><img alt="" border="0" data-original-height="139" data-original-width="443" src="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEhR37vjIZI0DR5vzrYuHD5TRQnJTq35SuLnjJ8DPyxZBMnlmS532ir_8M9_1z2FGQyV_DajMAJRaq8FUPPkVtGZ3nKSlfEvEXtfvFxwr0qwvgUERMcUsawwULKuuK2A1pRSviV5uHtDDWulKlfNCb5aN4oeZbLt3CXkApayYg6uMzxE0bd2VhTl8mRaVO0/s1600/bob.jpg"/></a></div> </div>
<div class="answer"><p>β
A= Insects B= Fishes </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question">3) Select the Assisted Reproductive Technique that uses an early embryo with up to 8 blastomeres. <p> a. ZIFT b. IUT c. GIFT d. IUI </div>
<div class="answer"><p>β
a. ZIFT </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> 4) Name the phenomenon where both phenotypic and genotypic ratios are found to be same. </div>
<div class="answer"> <p>β
Incomplete dominance </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question">5) Expand SNPs. </div>
<div class="answer"><p>β
Single Nucleotide Polymorphisms. </div>
<button class="answer-button">View Answer</button>
</div>
<p style="font-size: 18px; font-family: Arial; text-align: left; color: #5c5c5c; background-color: #ebeaec; padding: 10px;"> <b> <i>II. Answer any 9 questions from 6 β 16. Each carries 2 scores. (9 x 2 = 18)</i> </b> </p>
<div class="box">
<div class="question"> 6) Symbols used in human pedigree analysis and their meanings are provided in the table. Fill the blanks with suitable symbols or meanings. <div class="separator" style="clear: both;"><a href="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEj4vq_45_aMeDEL5eVUqFsj-pHhBY7f3-vXaFmFrra0iD0AhHkL0Ucecq3c6Z2ZGLu8PuHUNHtr-_Y0kjMNs2r1HlVAVk82zQIvXgbMen-mnnnHfY3tbZOS-WnprYoQReErHYj5OzYHu2_fKWWV5Hh6jTbH3AulfGPPI00AKp5RTErvJB-NaTmt2i9ORK4/s1600/bob.jpg" style="display: block; padding: 1em 0; text-align: center; "><img alt="" border="0" data-original-height="244" data-original-width="517" src="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEj4vq_45_aMeDEL5eVUqFsj-pHhBY7f3-vXaFmFrra0iD0AhHkL0Ucecq3c6Z2ZGLu8PuHUNHtr-_Y0kjMNs2r1HlVAVk82zQIvXgbMen-mnnnHfY3tbZOS-WnprYoQReErHYj5OzYHu2_fKWWV5Hh6jTbH3AulfGPPI00AKp5RTErvJB-NaTmt2i9ORK4/s1600/bob.jpg"/></a></div> </div>
<div class="answer"> <p>β
<b>Answer</b></p> a. Male <p> b. βͺ <p> c. Sex unspecified <p> d. β¬ </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> 7) Observe the graph given. <div class="separator" style="clear: both;"><a href="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEitll7O3AoD686y1_YA_8gq7XLbWoVlOGgytypzOluJgQLr-CuqHMfW5RfO29WUeuHjvikVebXmR092VRVQeE66sWYV9Qupns7GqJKCC09IbbOWWOfpyjXfGilhQTSqOcBBy56XuGSxp6jJzxxMGU3p1rnJkE7Z7944y7D3T-hsuEmLhtyWGbkXz1M3MyI/s1600/bob.jpg" style="display: block; padding: 1em 0; text-align: center; "><img alt="" border="0" data-original-height="209" data-original-width="588" src="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEitll7O3AoD686y1_YA_8gq7XLbWoVlOGgytypzOluJgQLr-CuqHMfW5RfO29WUeuHjvikVebXmR092VRVQeE66sWYV9Qupns7GqJKCC09IbbOWWOfpyjXfGilhQTSqOcBBy56XuGSxp6jJzxxMGU3p1rnJkE7Z7944y7D3T-hsuEmLhtyWGbkXz1M3MyI/s1600/bob.jpg"/></a></div> a) What do A and B stand for? <p> b) Mention one function A and B.
</div>
<div class="answer"> <p>β
<b>Answer</b></p> a) A= Estrogen B= Progesterone <p> b) Estrogen stimulates proliferation of ruptured uterine endometrium. <p> Progesterone helps to maintain the endometrium for implantation and other events of pregnancy. </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> 8) A DNA molecule which contains most of its nitrogen in the form of <sup>15</sup>N is allowed to replicate in a medium containing the nitrogen source <sup>14</sup>N. <p> a. What will be the percentage of DNA strands that contain <sup>15</sup>N after 2 rounds of replication? <p> b. Who conducted this experiment and what conclusion they reached from this experiment? </div>
<div class="answer"> <p>β
<b>Answer</b></p> a) After 2 rounds of replication, 25% of the DNA strands will contain <sup>15</sup>N. <p> b) The experiment was conducted by Matthew Meselson and Franklin Stahl. <p> Their conclusion was that DNA replication is semi-conservative, meaning each new DNA molecule consists of one parental strand and one newly synthesized strand. </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> 9) Match the following: <div class="separator" style="clear: both;"><a href="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEgQXC9wY8BTEVl_zDGYaixieylUC9FHhsmDUpikraHp11g_hAX-MMW4lQEMN0B0-qLrrtoIffuyH7GVs9p3D2Dv4X7Uv7cwfjuodTnkZMu3AzOxM2ogi0MxjpIAlVsTkGsI_2qW_edpeKqzP2nn24ZnK6GLQps4vIPVsVLlKpae4GhIoD5_S1aHOffpdvo/s1600/bob.jpg" style="display: block; padding: 1em 0; text-align: center; "><img alt="" border="0" data-original-height="175" data-original-width="619" src="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEgQXC9wY8BTEVl_zDGYaixieylUC9FHhsmDUpikraHp11g_hAX-MMW4lQEMN0B0-qLrrtoIffuyH7GVs9p3D2Dv4X7Uv7cwfjuodTnkZMu3AzOxM2ogi0MxjpIAlVsTkGsI_2qW_edpeKqzP2nn24ZnK6GLQps4vIPVsVLlKpae4GhIoD5_S1aHOffpdvo/s1600/bob.jpg"/></a></div></div>
<div class="answer"> <p>β
<b>Answer</b></p> <div class="separator" style="clear: both;"><a href="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEhj3K7Z2yGrp0wCMHULY0aZc3gKaCU7wmvOBgR2TZOMAgk_xRp4CSMUAZnWZg-6-2If_dRUSwbmGZVgW_HKfSAEFHYYZVfrpnXxdQ1Tc3-jdpfZHhzd5wVk2ok5i_Fu3dmQdEO9z329b30oTTA6IkBBZynu7j7QEByQ5-BR7otPnMWfM6tdGWq4vQ7ze8Q/s1600/bob2.png" style="display: block; padding: 1em 0; text-align: center; "><img alt="" border="0" data-original-height="160" data-original-width="640" src="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEhj3K7Z2yGrp0wCMHULY0aZc3gKaCU7wmvOBgR2TZOMAgk_xRp4CSMUAZnWZg-6-2If_dRUSwbmGZVgW_HKfSAEFHYYZVfrpnXxdQ1Tc3-jdpfZHhzd5wVk2ok5i_Fu3dmQdEO9z329b30oTTA6IkBBZynu7j7QEByQ5-BR7otPnMWfM6tdGWq4vQ7ze8Q/s1600/bob2.png"/></a></div> </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> 10) A list of human diseases is given below. Categorize them into distinct groups with suitable titles. <p> <center> Ascariasis, Typhoid, Diphtheria, Malaria, Pneumonia, Amoebiasis, Elephantiasis </center> </div>
<div class="answer"> <p>β
<b>Answer</b></p> Human diseases: <p> β’ <b>Bacterial diseases:</b> Typhoid, Pneumonia, Diphtheria <p> β’ <b>Protozoan diseases:</b> Malaria, Amoebiasis <p> β’ <b>Helminth diseases:</b> Ascariasis, Elephantiasis </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> 11) Raju had lost his mother at birth. He is unhealthy and prone to diseases easily. In his doctorβs opinion, Rajuβs ill health is due to lack of drinking motherβs milk. How will you justify the doctorβs opinion in the light of your knowledge of immunity? </div>
<div class="answer"> <p>β
<b>Answer</b></p> Mother's milk especially colostrum provides essential antibodies and immune factors that contribute to the development of the infant's immune system. Antibodies in the milk protect the baby from infections and diseases. The lack of these immune-boosting elements in Raju's early life made him unhealthy and prone to diseases. </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> 12) Central dogma of molecular biology is given in the diagram. <div class="separator" style="clear: both;"><a href="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEg2KC-EPkURE4KpvTkQ4REYTIA7ntuxPH6Y0fRdj4iqfj_Zix_-SPmd_Uy6RnO7dkpd3x-HcJTD2snKiG0WhGCRolmRk_BSCazMphhYTQo62jnKu6dcHkheq9tRghr4Op9JKnP1MkLae-6VJ3pRbXbkF57rvUF5R9-aPVMtOcqYdPYbbIIBSEjpSmxw_9k/s1600/bob.jpg" style="display: block; padding: 1em 0; text-align: center; "><img alt="" border="0" data-original-height="86" data-original-width="439" src="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEg2KC-EPkURE4KpvTkQ4REYTIA7ntuxPH6Y0fRdj4iqfj_Zix_-SPmd_Uy6RnO7dkpd3x-HcJTD2snKiG0WhGCRolmRk_BSCazMphhYTQo62jnKu6dcHkheq9tRghr4Op9JKnP1MkLae-6VJ3pRbXbkF57rvUF5R9-aPVMtOcqYdPYbbIIBSEjpSmxw_9k/s1600/bob.jpg"/></a></div> a. What do A, B and C stand for? <p> b. In which organisms, the central dogma is reversed? </div>
<div class="answer"> <p>β
<b>Answer</b></p> a) A= Replication <p> B= Transcription <p> C= Translation <p> b) Retroviruses </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> 13) Certain facts related to a human disorder are given. <p> β’ It is an inborn error in metabolism. <p> β’ It is inherited as an autosomal recessive trait. <p> β’ The affected person is mentally retarded. <p> a. Name the disorder. <p> b. What are the physiological processes behind this mental retardation? </div>
<div class="answer"> <p>β
<b>Answer</b></p> a) Phenylketonuria. <p> b) The affected individual lacks the enzyme <i>phenylalanine hydroxylase</i>. As a result, phenylalanine accumulates and converts into phenyl pyruvic acid and other derivatives. They accumulate in brain resulting in mental retardation. </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> 14) A genetic cross is represented below. <div class="separator" style="clear: both;"><a href="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEj_183Qsx649stRemnrHAe_CgEvkL9K2ZDHsrhRdOwCsR_IzgREcVYJ4s0plpnpuRdfOOMntELgT56VoxggyLUESjG9PaJEPhxOuBrAW3Rwr4sRpQqE7xpGAzDqsq5BPzchZfO1OOUluKv5VRhKjh5snI2UTVtjhS0zPdUNuWxAWsqoUgW2TdrAYG2z-bM/s1600/bob.jpg" style="display: block; padding: 1em 0; text-align: center; "><img alt="" border="0" data-original-height="163" data-original-width="233" src="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEj_183Qsx649stRemnrHAe_CgEvkL9K2ZDHsrhRdOwCsR_IzgREcVYJ4s0plpnpuRdfOOMntELgT56VoxggyLUESjG9PaJEPhxOuBrAW3Rwr4sRpQqE7xpGAzDqsq5BPzchZfO1OOUluKv5VRhKjh5snI2UTVtjhS0zPdUNuWxAWsqoUgW2TdrAYG2z-bM/s1600/bob.jpg"/></a></div> a. Identify the given cross and mention the ratio. <p> b. Elaborate upon the significance of such a cross. </div>
<div class="answer"> <p>β
<b>Answer</b></p> a. Test cross. <p> Ratio is 1:1. <p> b. Test cross is used to find out unknown genotype of a character. </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> 15) Mention any four factors that affect Hardy-Weinberg equilibrium. </div>
<div class="answer"> <p>β
<b>Answer</b></p> Gene migration, genetic drift, mutation, genetic recombination and natural selection. </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> 16) Some terms related to biodiversity conservation are given. Arrange these terms under two suitable headings. <p> <center> Biosphere reserves, National parks, Zoological parks, Wildlife sanctuaries, Cryopreservation of gametes, Seed banks, Botanical gardens, Sacred groves </center> </div>
<div class="answer"> <p>β
<b>Answer</b></p> <div class="separator" style="clear: both;"><a href="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEgGNTczJvP7ZDN1v9-1SZJ9w_PIj8zqCgreNk1Fm6vAR7ZrIVcx9bgei7wz3KvXAMAWmK9-cc52Pdsa4GQjRi1yAYdocdYLbzWlBLs6YvmtlFdwX0kxEeAE8L_4e_XRNHxEhxRNgbROJa1_jmy_vl0gw6Y74GPAqiZnRe8Afq4KEP73bE5VIKVvDlopD4Y/s1600/bob2.png" style="display: block; padding: 1em 0; text-align: center; "><img alt="" border="0" data-original-height="196" data-original-width="657" src="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEgGNTczJvP7ZDN1v9-1SZJ9w_PIj8zqCgreNk1Fm6vAR7ZrIVcx9bgei7wz3KvXAMAWmK9-cc52Pdsa4GQjRi1yAYdocdYLbzWlBLs6YvmtlFdwX0kxEeAE8L_4e_XRNHxEhxRNgbROJa1_jmy_vl0gw6Y74GPAqiZnRe8Afq4KEP73bE5VIKVvDlopD4Y/s1600/bob2.png"/></a></div> </div>
<button class="answer-button">View Answer</button>
</div>
<p style="font-size: 18px; font-family: Arial; text-align: left; color: #5c5c5c; background-color: #ebeaec; padding: 10px;"> <b> <i>III. Answer any 3 questions from 17 β 20. Each carries 3 scores. (3 x 3 = 9)</i> </b> </p>
<div class="box">
<div class="question"> 17) Diagram shown below is a surgical method used for female sterilization. <div class="separator" style="clear: both;"><a href="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEjDXZrbBM6iHd7wNe8Vr17pNRolcNfTcHM6Z4eC61vX0QJQxzcBw3ueENJPeHzMvzYAtmbjMRkGkV5V3-iVJtVskPNYPxcy9893hslFQBe_sg7dkrks5EzipzE_XJhy2Td81k324FduX1vQTanvzC1mqKZI3PinZWOiDQ6RkdUlB9RiAVCWPRpmPij5pdM/s1600/bob.jpg" style="display: block; padding: 1em 0; text-align: center; "><img alt="" border="0" data-original-height="341" data-original-width="416" src="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEjDXZrbBM6iHd7wNe8Vr17pNRolcNfTcHM6Z4eC61vX0QJQxzcBw3ueENJPeHzMvzYAtmbjMRkGkV5V3-iVJtVskPNYPxcy9893hslFQBe_sg7dkrks5EzipzE_XJhy2Td81k324FduX1vQTanvzC1mqKZI3PinZWOiDQ6RkdUlB9RiAVCWPRpmPij5pdM/s1600/bob.jpg"/></a></div> <p> a. Name the surgical method and mention how it works. <p> b. Mention one advantage and one disadvantage of this method. <p> c. Name two contraceptives that can be used as emergency contraceptives. </div>
<div class="answer"> <p>β
<b>Answer</b></p> a) Tubectomy. <p> It blocks gamete transport thereby prevents fertilization and conception. <p> b) <b>Advantage:</b> Highly effective. <p> <b>Disadvantage:</b> Reversibility is poor. <p> c) Progestogens or progestogen-oestrogen combinations & IUDs. </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> 18) Observe the diagram provided and identify the process. <div class="separator" style="clear: both;"><a href="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEj4aNbNiylHMQH_M8IIly7J50UGia0HAHAh3LWE2rFECQPsvQS_v9LwM-Aj8uQGqfCN7DvxCws-IxzCnDk6huxGnZlE1noFOt740OyuUVnj7AoYk02FT2mXAn7yo8dPzKakDThppLicLEAzQHVJtsxtUsS-MOOzZpbTG5DBZTQgj-ugrsMcOZJICQgPKiA/s1600/bob.jpg" style="display: block; padding: 1em 0; text-align: center; "><img alt="" border="0" data-original-height="267" data-original-width="442" src="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEj4aNbNiylHMQH_M8IIly7J50UGia0HAHAh3LWE2rFECQPsvQS_v9LwM-Aj8uQGqfCN7DvxCws-IxzCnDk6huxGnZlE1noFOt740OyuUVnj7AoYk02FT2mXAn7yo8dPzKakDThppLicLEAzQHVJtsxtUsS-MOOzZpbTG5DBZTQgj-ugrsMcOZJICQgPKiA/s1600/bob.jpg"/></a></div> <p> a. Label A, B, C and D. <p> b. Why are gametes produced haploid even though the gamete mother cells are diploid? </div>
<div class="answer"> <p>β
<b>Answer</b></p> a) A= Primary oocyte <p> B= First polar body <p> C= Secondary oocyte <p> D= Ovum (Ootid) <p> b) Gametes are produced as haploid cells by meiosis. When haploid gametes fuse during fertilization, the resulting zygote restores the diploid chromosome number. </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> 19) Given below is the diagram of a replication fork drawn by a student. <div class="separator" style="clear: both;"><a href="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEjiOJ7IILrLJ7PHAdqCbQwOIM8kv-u1u0Mfnxe29FEax-Mp9eLH5WIUtlaJmCCKESfDJkK7Rma_HJ7YE9O-Xc90oVrMtBC1MrLGmwtZF40yMFuUVVyjOP_zdhoG2tuliGQb0lOd2nOmpwJRBQxh049TCSUuZ9NKa4lrm0yCLBqbQ7m6CV_3NxIjpn2f1Mo/s1600/bob.jpg" style="display: block; padding: 1em 0; text-align: center; "><img alt="" border="0" data-original-height="146" data-original-width="267" src="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEjiOJ7IILrLJ7PHAdqCbQwOIM8kv-u1u0Mfnxe29FEax-Mp9eLH5WIUtlaJmCCKESfDJkK7Rma_HJ7YE9O-Xc90oVrMtBC1MrLGmwtZF40yMFuUVVyjOP_zdhoG2tuliGQb0lOd2nOmpwJRBQxh049TCSUuZ9NKa4lrm0yCLBqbQ7m6CV_3NxIjpn2f1Mo/s1600/bob.jpg"/></a></div> <p> a. Redraw the diagram correctly and label it. <p> b. Why does discontinuous synthesis of DNA occur in one strand? </div>
<div class="answer"> <p>β
<b>Answer</b></p> Replication fork. a. <div class="separator" style="clear: both;"><a href="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEh9gytByEgjUY6u9ad2Sdah3doPKBCh75cMIQHkSg-kcMJP6I1yR7Jop0FctuZkndRU8rmmHhJqo5LkVJwT5byi93_WvzW2LsPTEtthbhU5-DeDVtAtjMUQUTFc8dpVbbKRW6KND3ihpywAteaRFR6vAZhxcN8Vg41HAh0tauWLUOkdtNG12jRWXnfMsy4/s1600/bob2.png" style="display: block; padding: 1em 0; text-align: center; "><img alt="" border="0" data-original-height="596" data-original-width="549" src="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEh9gytByEgjUY6u9ad2Sdah3doPKBCh75cMIQHkSg-kcMJP6I1yR7Jop0FctuZkndRU8rmmHhJqo5LkVJwT5byi93_WvzW2LsPTEtthbhU5-DeDVtAtjMUQUTFc8dpVbbKRW6KND3ihpywAteaRFR6vAZhxcN8Vg41HAh0tauWLUOkdtNG12jRWXnfMsy4/s1600/bob2.png"/></a></div> b. Discontinuous synthesis of DNA occurs in one strand because DNA polymerase can only add nucleotides in a 5' to 3' direction. As the replication fork opens, this strand is synthesized in short, discontinuous fragments. </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> 20) Observe the diagrammatic representation and answer the questions: <div class="separator" style="clear: both;"><a href="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEiwInWtWv1g3g71TrDGH6A7FiJQDCgqzCsYP_p2zJAFOWvCsuJQOKk0US-Yg2V4dC_d1dWe5O-9dKQCAp9mjavI7Yv62N_lvhfywn5pcwABI1afxMuuhEVg9hND3bmg-FcX8Up859vAxRc4ljX3vy9zOQeyqrFas_lWFFzp7B_OWi7dy-hNBdU1wiIDwwU/s1600/bob.jpg" style="display: block; padding: 1em 0; text-align: center; "><img alt="" border="0" data-original-height="197" data-original-width="297" src="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEiwInWtWv1g3g71TrDGH6A7FiJQDCgqzCsYP_p2zJAFOWvCsuJQOKk0US-Yg2V4dC_d1dWe5O-9dKQCAp9mjavI7Yv62N_lvhfywn5pcwABI1afxMuuhEVg9hND3bmg-FcX8Up859vAxRc4ljX3vy9zOQeyqrFas_lWFFzp7B_OWi7dy-hNBdU1wiIDwwU/s1600/bob.jpg"/></a></div> <p> a. Explain the phenomenon shown in the figure. <p> b. How can it be considered as evidence of evolution? <p> c. Write any other example for this phenomenon. Explain. </div>
<div class="answer"> <p>β
<b>Answer</b></p> a) Adaptive radiation of marsupials of Australia. <p> It is the evolution of different species from an ancestor in a geographical area starting from a point and radiating to other areas of geography (habitats). <p> b) Adaptive radiation is considered as evidence of evolution because it explains how a single ancestral species can diversify into multiple species. <p> c) Darwinβs finches. Despite having a common ancestor, they have evolved different beak shapes and sizes, enabling them to utilize different foods. </div>
<button class="answer-button">View Answer</button>
</div>
<script>
// Get all the answer buttons
const answerButtons = document.querySelectorAll('.answer-button');
// Add a click event listener to each answer button
answerButtons.forEach(button => {
button.addEventListener('click', () => {
// Get the answer section for this button
const answerSection = button.previousElementSibling;
// Toggle the answer section's visibility
answerSection.classList.toggle('visible');
// Change the button text to "Hide Answer" or "View Answer"
if (answerSection.classList.contains('visible')) {
button.textContent = 'Hide Answer';
button.classList.add('hide-answer');
} else {
button.textContent = 'View Answer';
button.classList.remove('hide-answer');
}
});
});
</script>
<html>
<head>
<style>
.special-paragraph {
margin-bottom: -10px; /* Adjust this value to reduce the space */
color: #333333;
font-family: Arial, sans-serif;
font-size: 23px;
font-weight: bold;
line-height: 1.5;
padding: 7px;
text-align: center;
border-radius: 10px;
}
.green-bg {
background-color: #ddffd9; /* Green background */
}
.blue-bg {
background-color: #b0eaff; /* Blue background */
}
</style>
</head>
<body>
<p class="special-paragraph green-bg">
<a href="https://www.bankofbiology.com/2020/10/hse-1-2-model-qp-online-exam-series.html" style="color: green;"> π Other Question Papers </a>
</p>
<p class="special-paragraph blue-bg">
<a href="https://www.bankofbiology.com/p/question-bank.html" style="color: blue;"> π Exam Special Materials </a>
</p>
</body>
</html>
<div class="blogger-post-footer"><p> Β© copyright 2024 β All rights reserved </p>
<a href=βhttps://www.bankofbiology.comβ>bankofbiology.com</a></div>Abu Raniyahttp://www.blogger.com/profile/14189496606355139812noreply@blogger.com0tag:blogger.com,1999:blog-6823671394482492613.post-10944818329021956102024-03-04T11:32:00.079+05:302024-03-09T10:06:21.135+05:30Plus Two Biology (Bot + Zoo) | Practice Model Question Paper PDF with Answer key | SET 3<!DOCTYPE html>
<html>
<head>
<title>Example Webpage</title>
<style>
body {
user-select: none; /* Prevent selection of text */
-moz-user-select: none; /* Firefox */
-webkit-user-select: none; /* Safari and Chrome */
-ms-user-select: none; /* Internet Explorer/Edge */
}
h1 {
user-select: text; /* Allow selection of title */
}
</style>
</head>
<p style="font-size: 25px; font-family: Arial; text-align: center; color: #2068d4; line-height: 1.5;"> <b> π <a href="https://drive.google.com/file/d/1CmhYvk_meSMnDF5dkoHjeygCgDvLRmIT/view?usp=sharing" target="_blank">Download Biology Question Paper PDF - SET 3</a> </b> </p>
<p style="font-size: 30px; font-family: Arial; text-align: center; color: #0c8a7d; background-color: #a2f5d3; padding: 10px;"> <b> PART A: BOTANY </b></p>
<style>
/* Customize the box style */
.box {
background-color: #ffffff;
border: 1px solid #ffffff;
border-radius: 1px;
padding: 10px;
margin-bottom: 10px;
margin-right: -14px;
margin-left: -14px;
}
/* Customize the question style */
.question {
font-size: 18px;
font-weight: bold;
color: #3D4849;
font-family: Open Sans;
margin-bottom: 10px;
}
/* Customize the answer style */
.answer {
font-size: 18px;
font-weight: normal;
font-family: Roboto;
margin-bottom: 10px;
background-color: #e7ffde;
}
/* Hide the answer by default */
.answer {
display: none;
}
/* Customize the view/hide answer button */
.answer-button {
background-color: #4CAF50;
border: none;
border-radius: 5px;
color: white;
padding: 8px 16px;
text-align: center;
text-decoration: none;
display: inline-block;
font-size: 18px;
margin-bottom: 1px;
cursor: pointer;
}
/* Style the button differently when it changes to "Hide Answer" */
.answer-button.hide-answer {
background-color: #f44336;
}
/* Show the answer when the visible class is added */
.answer.visible {
display: block;
}
.table-text {
display: grid;
grid-template-columns: 50% 50%;
grid-gap: none;
margin-top: 5px;
border-collapse: collapse;
}
.table-text-2 {
display: grid;
grid-template-columns: 33.33% 33.33% 33.33%;
grid-gap: none;
margin-top: 5px;
border-collapse: collapse;
}
.table-text-header,
.table-text-cell {
padding: 5px;
border: 1px solid black;
text-align: left;
}
.table-text-header {
font-weight: bold;
text-align: center;
}
.no-break {
white-space: nowrap;
}
.tab {
text-indent: 40px; /* Adjust the value as per your preference */
}
</style>
<p style="font-size: 18px; font-family: Arial; text-align: left; color: #5c5c5c; background-color: #ebeaec; padding: 10px;"> <b> <i>I. Answer any 3 questions from 1 β 5. Each carries 1 score. (3 x 1 = 3)</i> </b> </p>
<div class="box">
<div class="question">1) Note the relationship between first two words and fill up the fourth place. <p> Number of births in the population during a given period: Natality <p> Number of deaths in the population during a given period: β¦β¦β¦β¦β¦β¦ </div>
<div class="answer"><p>β
Mortality. </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question">2) The capacity to generate a whole plant from any cell/explant is called β¦β¦β¦β¦... </div>
<div class="answer"><p>β
Totipotency. </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question">3) Restriction enzymes belong to a larger class of enzymes called nucleases. These are of two kinds such as β¦β¦β¦β¦ and β¦β¦β¦β¦β¦. </div>
<div class="answer"><p>β
<i>Endonucleases</i> and <i>Exonucleases</i>. </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> 4) Label the parts A and B in the given figure. <div class="separator" style="clear: both;"><a href="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEiY4dmrLkGIRPkDi8sg80QY6sbDQI1ASisiBMhAaFcbMwlFW4FQV31mkyqqSusefTDDg2LmKhS5-TcRx6bdOJ54SthdYBoTWwHiLHe72UPZOqGNj02I7hSwGV6w9QGpK5twTLOJeSE87crPIAFHz9_wZLbGuCHfj7Nlupo74O_OnTt9qvH7SgyRHDgh5tU/s1600/bob.jpg" style="display: block; padding: 1em 0; text-align: center; "><img alt="" border="0" data-original-height="220" data-original-width="301" src="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEiY4dmrLkGIRPkDi8sg80QY6sbDQI1ASisiBMhAaFcbMwlFW4FQV31mkyqqSusefTDDg2LmKhS5-TcRx6bdOJ54SthdYBoTWwHiLHe72UPZOqGNj02I7hSwGV6w9QGpK5twTLOJeSE87crPIAFHz9_wZLbGuCHfj7Nlupo74O_OnTt9qvH7SgyRHDgh5tU/s1600/bob.jpg"/></a></div></div>
<div class="answer"> <p>β
A= Vegetative cell B= Generative cell. </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question">5) Expand the abbreviation GPP. </div>
<div class="answer"><p>β
Gross Primary Productivity. </div>
<button class="answer-button">View Answer</button>
</div>
<p style="font-size: 18px; font-family: Arial; text-align: left; color: #5c5c5c; background-color: #ebeaec; padding: 10px;"> <b> <i>II. Answer any 9 questions from 6 β 16. Each carries 2 scores. (9 x 2 = 18)</i> </b> </p>
<div class="box">
<div class="question"> 6) Consider pond as an ecosystem showing the number of individuals in the following categories. <p> <center> Carnivores- 2500, Producers- 15000, Herbivores- 5000 </center> <p> a. Draw the pyramid of numbers in this ecosystem. <p> b. Comment on the energy flow in the ecosystem. </div>
<div class="answer"> <p>β
<b>Answer</b></p> (a) Pyramid of numbers. <div class="separator" style="clear: both;"><a href="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEhbylqSSo_3rWFxH9rLs7xxL0ExqRa6b5wxyN65F8m-hArD8hIUKye-UIJYeU_dTua8V4rv6rYLEsi2E1W803OFj-uG-UcBHfwmX4Zz5hKjzR6psaHdiHcyfDeEvJds8AzHlMHj_DeJECLyu7Ye4MPI6Hd35OY0cYaQ0daCveZh-9ra8nmWfjK0grvtr30/s1600/bob2.png" style="display: block; padding: 1em 0; text-align: center; "><img alt="" border="0" data-original-height="226" data-original-width="426" src="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEhbylqSSo_3rWFxH9rLs7xxL0ExqRa6b5wxyN65F8m-hArD8hIUKye-UIJYeU_dTua8V4rv6rYLEsi2E1W803OFj-uG-UcBHfwmX4Zz5hKjzR6psaHdiHcyfDeEvJds8AzHlMHj_DeJECLyu7Ye4MPI6Hd35OY0cYaQ0daCveZh-9ra8nmWfjK0grvtr30/s1600/bob2.png"/></a></div>(b) Energy in an ecosystem flows from producers to herbivores and then to carnivores. With each transfer, some energy is lost as heat. This results in fewer carnivores than herbivores or producers. </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> 7) Genetically Modiο¬ed Organism (GMO) is always a debatable topic among scientists, academicians and public. State any four advantages of GMOs. </div>
<div class="answer"> <p>β
<b>Answer</b></p> <b>Advantages of GMOs: </b> <p> β’ It makes crops more tolerant to abiotic stresses. <p> β’ Pest-resistant crops reduce the use of chemical pesticides. <p> β’ It reduces post-harvest losses. <p> β’ It increases efficiency of mineral usage by plants. <p> β’ It enhances nutritional value of food. E.g. Golden rice. </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> 8) A picture showing transverse section of a young anther is given below. Label A to D. <div class="separator" style="clear: both;"><a href="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEh6C67OrVUQPgp9C6ol2U4g4zFLs-ZaEnLfpGs08PAFYePLJpm7FknXDp31QY0J8-SXfZeLNA36xVQDJqjSdUEzHHrAmQi_mMw41Z8vxV943kmG7gFYSYZXIFJyZYZdy_p-UeWs_07QqoyWeHc6CqwkoADpCVIz3VfS9KOTmGvrEYqUOH1DuU7yaYOGp4s/s1600/bob.jpg" style="display: block; padding: 1em 0; text-align: center; "><img alt="" border="0" data-original-height="391" data-original-width="613" src="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEh6C67OrVUQPgp9C6ol2U4g4zFLs-ZaEnLfpGs08PAFYePLJpm7FknXDp31QY0J8-SXfZeLNA36xVQDJqjSdUEzHHrAmQi_mMw41Z8vxV943kmG7gFYSYZXIFJyZYZdy_p-UeWs_07QqoyWeHc6CqwkoADpCVIz3VfS9KOTmGvrEYqUOH1DuU7yaYOGp4s/s1600/bob.jpg"/></a></div></div>
<div class="answer"> <p>β
<b>Answer</b></p> A= Connective <p> B= Endothecium <p> C= Sporogenous tissue <p> D= Tapetum </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> 9) Bt toxin is produced by <i>Bacillus thuringiensis</i> that can kill certain insects. <p> a. Name the bacterial gene that is producing this toxin. <p> b. Why the toxin produced by the bacterium is non-toxic to it? </div>
<div class="answer"> <p>β
<b>Answer</b></p> a) Cry gene. <p> b) The Bt toxin is non-toxic to the bacterium itself because it is produced in an inactive form called a protoxin. It only becomes active in the alkaline gut of certain insects.
</div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> 10) Ecological pyramids are usually upright. Meanwhile some pyramid of biomass is inverted. Explain the reason. </div>
<div class="answer"> <p>β
<b>Answer</b></p> Inverted pyramid of biomass occurs when the standing crop (biomass) of primary consumers (herbivores) is higher than the standing crop of producers (plants). It is commonly observed in aquatic ecosystems where phytoplankton (producers) grow and get replaced quickly. This allows a larger group of zooplankton (primary consumers). </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> 11) What is Biopiracy? Explain with an example. </div>
<div class="answer"> <p>β
<b>Answer</b></p> Biopiracy is the use of bio-resources by multinational companies and other organizations without proper authorization from the countries and people concerned. <p> Certain companies have got patents for products and technologies that make use of the genetic materials, plants etc. that have been identified, developed and used by farmers and indigenous people of a country. E.g. Basmati rice, herbal medicines (turmeric, neem etc.). </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> 12) Population interactions may be beneficial or harmful. Briefly explain any two interactions with examples. </div>
<div class="answer"> <p>β
<b>Answer</b></p> <b>Mutualism:</b> It is a beneficial interaction where both species get benefit. E.g., Bees and flowering plants. The plants benefit from pollination, and bees get nectar. <p> <b>Predation: </b>It is an interaction where one organism (predator) is benefitted and other organism (prey) is harmed. E.g., Lions preying on zebras.
</div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> 13) After fertilization in flowering plants, seeds bearing embryos are found inside the fruits. <p> a. Name the parts that give rise to embryo and fruits. <p> b. What is the thick wall of the fruit that is protective in function called? </div>
<div class="answer"> <p>β
<b>Answer</b></p> a. The zygote gives rise to the embryo. <p> The ovary develops into the fruit. <p> b. Pericarp.
</div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> 14) Distinguish between GFC and DFC. </div>
<div class="answer"> <p>β
<b>Answer</b></p> <b>Grazing Food Chain (GFC):</b> Here, primary consumer feeds on living plants (producer). <p> E.g.
Grass (producer) β Goat (primary consumer) β Man <p> Detritus Food Chain (DFC): Here, primary consumer feeds on dead organic matter (detritus). Death of organism is the beginning of the DFC. </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> 15) Recombinant DNA technology can be accomplished only if we have the following key tools i.e. Restriction enzymes. Polymerase enzyme, Ligases and Vectors. State the functions of <p> (a) <i>Ligases</i> (b) Restriction enzymes </div>
<div class="answer"> <p>β
<b>Answer</b></p> (a) <b>Ligases:</b> They help to link DNA strands together. They are used in recombinant DNA technology to connect the desired gene to the vector. <p> (b) <b>Restriction enzymes:</b> These are DNA-cutting enzymes that recognize specific sequences in DNA. It helps in determining the location at which the desired gene is inserted into the vector genome. </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> 16) Briefly explain Brood parasitism in birds. </div>
<div class="answer"> <p>β
<b>Answer</b></p> <b>Brood parasitism in birds:</b> <p> Here, the parasitic birds lay eggs in the nest of its host and lets the host incubate them. <p> During evolution, eggs of the parasitic bird have evolved to resemble the hostβs egg in size and colour. So the host bird cannot detect and eject the foreign eggs easily. <p> E.g. Brood parasitism between cuckoo and crow. </div>
<button class="answer-button">View Answer</button>
</div>
<p style="font-size: 18px; font-family: Arial; text-align: left; color: #5c5c5c; background-color: #ebeaec; padding: 10px;"> <b> <i>III. Answer any 3 questions from 17 β 20. Each carries 3 scores. (3 x 3 = 9)</i> </b> </p>
<div class="box">
<div class="question"> 17) (a) One of the speakers in the National Childrenβs Science Congress delivered a talk about Transgenic animals. Explore any 2 benefits of transgenic animals. <p> (b) Expand ELISA. </div>
<div class="answer"> <p>β
<b>Answer</b></p> <b>(a) 2 benefits of transgenic animals:</b> <p> β’ <b>To study regulation of genes and their action on normal physiology & development:</b> E.g. Study of insulin-like growth factor. Genes (from other species) that alter formation of this factor are introduced and the biological effects are studied. This gives information about biological role of the factor. <p> β’ <b>To study the contribution of genes in the development of a disease and thereby new treatments:</b> E.g. transgenic models for human diseases such as cancer, cystic fibrosis, rheumatoid arthritis & Alzheimerβs. <p> (b) Enzyme Linked Immuno-Sorbent Assay.
</div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> 18) Transfer of pollen grains from the anther to the stigma of a flower is called pollination. Grass plants generally have small, inconspicuous flowers while plants belonging to many angiosperm families bear conspicuous coloured flowers. <p> a. Comment on the type of pollination taking place in these two groups. <p> b. What are the salient features present in these two groups for effective pollination? </div>
<div class="answer"> <p>β
<b>Answer</b></p> a. Grass plants undergo Anemophily (wind pollination). <p> Angiosperms with conspicuous, coloured flowers undergo entomophily (insect pollination) and ornithophily (bird pollination). <p> <b>b. For grass plants:</b> <p> β’ The flowers produce enormous amount of pollen. <p> β’ Pollen grains are light and non-sticky. <p> β’ They often possess well-exposed stamens. <p> β’ Large, feathery stigma to trap air-borne pollen grains. <p> <b>For Angiosperms with conspicuous, coloured flowers:</b> <p> β’ Large, colourful, fragrant and rich in nectar. <p> β’ The pollen grains are generally sticky. <p> β’ Small flowers form inflorescence to make them visible. </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> 19) Given below is the bar diagram showing age structure of three different populations. Observe the diagram carefully and answer the following questions. <div class="separator" style="clear: both;"><a href="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEi-uuxZxz2PePBaBSND9MNL862fbkd1HVwyVjsjpPQkO9626LK_brGSh-DGHnNi8sRFFmIW277Niui0VZNfr3WUe0izEmGpydbs00prwey0SC9qfXRHRrA5gGPGXFC-zawAKyZQLucarpkUgCauGCeSnAiXwX9vUuIiOq23d-0Ba8n5klVZNV9-aQRCudQ/s1600/bob.jpg" style="display: block; padding: 1em 0; text-align: center; "><img alt="" border="0" data-original-height="205" data-original-width="833" src="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEi-uuxZxz2PePBaBSND9MNL862fbkd1HVwyVjsjpPQkO9626LK_brGSh-DGHnNi8sRFFmIW277Niui0VZNfr3WUe0izEmGpydbs00prwey0SC9qfXRHRrA5gGPGXFC-zawAKyZQLucarpkUgCauGCeSnAiXwX9vUuIiOq23d-0Ba8n5klVZNV9-aQRCudQ/s1600/bob.jpg"/></a></div>a. Identify the types of populations A, B and C. <p> b. Give a brief account of age pyramids. </div>
<div class="answer"> <p>β
<b>Answer</b></p> a) A= Expanding population, B = stable population C= Declining population. <p> b) If the age distribution in a population is plotted for the population, the resulting structure is called an age pyramid. For human population, the age pyramids generally show age distribution of males and females in a diagram. The shape of the pyramids reflects the growth status of the population - whether it is growing, stable or declining. </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> 20) The below picture shows cloning vector pBR322. <div class="separator" style="clear: both;"><a href="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEg3ORtQ50l4YW2QLuiqrrPwUD2mCBwd5UNg8KKxvGn6k8N48NxM93Njqc83Aes9KiODiFBYsb2nBqI3pD7Ry9XI6O5xl65ZNj7uHIsY2F8BPmYTi7Zmw4oJYes8QoDsl7J-FVpAn7-WRLUUH0jhT2H5lMwcRGmEFRXGn_KuoxUD6YgQZnHiqPr3QHN6Sb8/s1600/bob.jpg" style="display: block; padding: 1em 0; text-align: center; "><img alt="" border="0" data-original-height="365" data-original-width="441" src="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEg3ORtQ50l4YW2QLuiqrrPwUD2mCBwd5UNg8KKxvGn6k8N48NxM93Njqc83Aes9KiODiFBYsb2nBqI3pD7Ry9XI6O5xl65ZNj7uHIsY2F8BPmYTi7Zmw4oJYes8QoDsl7J-FVpAn7-WRLUUH0jhT2H5lMwcRGmEFRXGn_KuoxUD6YgQZnHiqPr3QHN6Sb8/s1600/bob.jpg"/></a></div>a. What is ori? Mention its importance. <p> b. How does the insertion of foreign DNA at Bam HI site select? <p> c. How many cloning sites are depicted in this vector as shown in the figure?
</div>
<div class="answer"> <p>β
<b>Answer</b></p> a) <i>ori</i> is a sequence where replication starts. <p> <b>Importance:</b> A piece of DNA linked to <i>ori</i> can replicate within the host cells. This also controls the copy number of linked DNA. So, for getting many copies of the target DNA, it should be cloned in a vector whose origin support high copy number. <p> b) In vector pBR322, foreign DNA is ligated at Bam H I site of tetracycline resistance gene. As a result, recombinant plasmid is formed. <p> c) Eight cloning sites. </div>
<button class="answer-button">View Answer</button>
</div>
<p style="font-size: 30px; font-family: Arial; text-align: center; color: #993d77; background-color: #ffe0f4; padding: 10px;"> <b> PART B: ZOOLOGY </b></p>
<p style="font-size: 18px; font-family: Arial; text-align: left; color: #5c5c5c; background-color: #ebeaec; padding: 10px;"> <b> <i>I. Answer any 3 questions from 1 β 5. Each carries 1 score. (3 x 1 = 3)</i> </b> </p>
<div class="box">
<div class="question">1) Observe the diagram below: <div class="separator" style="clear: both;"><a href="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEiXQ_i11o3F0fnHvAm2gO2600JQOk_i06fWjpduk0qSNEIwNw18Sdmzi8eD4PkUDC5FAOcq-RZCHnTR-EuPBcP50YV6M_kFlgYgUmOkKJDibpP-udmcM4F5_-25UJ0fbHdnkhZDb5UbW0mo6VUV_lyAE7ncLa5STyAtN0iYw7sJwQ_3mUDcRLOKGwcuUQ4/s1600/bob.jpg" style="display: block; padding: 1em 0; text-align: center; "><img alt="" border="0" data-original-height="67" data-original-width="181" src="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEiXQ_i11o3F0fnHvAm2gO2600JQOk_i06fWjpduk0qSNEIwNw18Sdmzi8eD4PkUDC5FAOcq-RZCHnTR-EuPBcP50YV6M_kFlgYgUmOkKJDibpP-udmcM4F5_-25UJ0fbHdnkhZDb5UbW0mo6VUV_lyAE7ncLa5STyAtN0iYw7sJwQ_3mUDcRLOKGwcuUQ4/s1600/bob.jpg"/></a></div>Which among the following is the complimentary sequence of the DNA fragment shown above? <p> a. 5β β ATTCG β 3β <p> b. 3β β ATTCG β 5β <p> <p> c. 3β β TAAGC β 5β <p> d. 3β β CGAAT β 5β </div>
<div class="answer"><p>β
c. 3β β TAAGC β 5β </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question">2) One among the contraceptive method is peculiar. Find the odd one. What is common among others? <p> a. Periodic abstinence <p> b. Coitus interruptus <p> c. Lactational amenorrhea <p> d. IUDs </div>
<div class="answer"><p>β
IUDs. Others are natural contraceptive methods. </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question">3) The process of fusion of a sperm with ovum is called β¦β¦β¦β¦. </div>
<div class="answer"><p>β
Fertilization </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> 4) Which of the following is not a Mendelian disorder? <p> <center> Colour blindness, Downβs syndrome, Haemophilia, Thalassemia </center> </div>
<div class="answer"> <p>β
Downβs syndrome </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question">5) Identify the disease shown in the following figure and write the causative organism of the disease. <div class="separator" style="clear: both;"><a href="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEhpW4U67l2GshXrxKUONVzyLBa5GBFRIL45xxyfVcPepb28YLU3S5ChTT03WDlTdrNVjUzxl0Wygm949maPe0yQOY4V1gLL3ib0hNvezqvj3jrkGuY-B7FVYuTOwpqKQIJxgGDflSRUnXt8a1a1xJ_BmuVMUNEudDP0n8Kz2_RlgNi3xbvlhpKI3uq_OC0/s1600/bob.jpg" style="display: block; padding: 1em 0; text-align: center; "><img alt="" border="0" data-original-height="348" data-original-width="253" src="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEhpW4U67l2GshXrxKUONVzyLBa5GBFRIL45xxyfVcPepb28YLU3S5ChTT03WDlTdrNVjUzxl0Wygm949maPe0yQOY4V1gLL3ib0hNvezqvj3jrkGuY-B7FVYuTOwpqKQIJxgGDflSRUnXt8a1a1xJ_BmuVMUNEudDP0n8Kz2_RlgNi3xbvlhpKI3uq_OC0/s1600/bob.jpg"/></a></div> </div>
<div class="answer"><p>β
Filariasis. Causative organism is <i>Wuchereria bancrofti</i>. </div>
<button class="answer-button">View Answer</button>
</div>
<p style="font-size: 18px; font-family: Arial; text-align: left; color: #5c5c5c; background-color: #ebeaec; padding: 10px;"> <b> <i>II. Answer any 9 questions from 6 β 16. Each carries 2 scores. (9 x 2 = 18)</i> </b> </p>
<div class="box">
<div class="question"> 6) The sequence of template strand of a gene is given below. <p> <center> 3β CACGTGGACTGAGGACTCCTC 5β </center> <p> Construct the base sequence of mRNA transcribed from this.</div>
<div class="answer"> <p>β
<b>Answer</b></p> 5β GUGCACCUGACUCCUGAGGAG 3β </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> 7) a) Arrange the given chemical compounds in the sequential order as per the concept of origin of life. <p> <center> (Ammonia, Hydrogen, Protein, Nucleic acid, Amino acid) </center> <p> b) Correlate Millerβs experiment with this. </div>
<div class="answer"> <p>β
<b>Answer</b></p> a) Hydrogen β Ammonia β Amino acid β Protein β Nucleic acid <p> b) Millerβs experiment simulated early Earth conditions and produced simple organic compounds like amino acids. It proves theory of chemical evolution.
</div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> 8) Make pairs by putting the related items together stating their relationship. <p> <center> <i>Monascus purpureus</i>, <i>Trichoderma polysporum</i>, Ethanol, Blood clot, <i>Streptokinase</i>, Statin, <i>Saccharomyces cerevisiae</i>, Cyclosporine </center> </div>
<div class="answer"> <p>β
<b>Answer</b></p> <i>Monascus purpureus</i> β Statin <p> <i>Trichoderma polysporum</i> β Cyclosporine <p> <i>Saccharomyces cerevisiae</i> β Ethanol <p> <i>Streptokinase</i> - Blood clot
</div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> 9) The treatment facility advertised on the brochure of a private clinic is shown below. <p> <center> IVF ZIFT GIFT IUI </center> <p> a. Can you suggest what type of a clinic it is? <p> b. Expand any three of them. </div>
<div class="answer"> <p>β
<b>Answer</b></p> a. Fertility clinic to treat Infertility. <p> b. IVF: <i>In-Vitro</i> Fertilization <p> ZIFT: Zygote Intrafallopian Transfer <p> GIFT: Gamete Intrafallopian Transfer <p> IUI: Intrauterine Insemination </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> 10) Lakshmi and Sujitha are two nursery students. Sujitha gets common cold very often. Lakshmi not. <p> a. How do you interpret this in an immunological aspect? <p> b. What are the common barriers protecting Lakshmi from cold? </div>
<div class="answer"> <p>β
<b>Answer</b></p> a) Immunologically, Lakshmi has a stronger immune system or better immunity against the common cold virus. <p> b) <b>Common barriers protecting Lakshmi.</b> <p> β’ Intact skin as a physical barrier. <p> β’ Mucous membranes in the respiratory tract trapping pathogens. <p> β’ Presence of antimicrobial substances in tears and saliva. </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> 11) A bacterial infection was effectively controlled by using a specific antibiotic for a long time. But now- a- days this antibiotic is not found to be so effective to control the said infection. Give a scientific explanation for this phenomenon based on evolution. </div>
<div class="answer"> <p>β
<b>Answer</b></p> This phenomenon is an example for natural selection by anthropogenic action. Over time, bacteria can evolve through natural selection to become resistant to antibiotics. This happens when some bacteria survive the antibiotic treatment due to genetic mutations. These bacteria multiply, leading to a population of antibiotic-resistant bacteria. </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> 12) After analyzing the karyotype of a short statured round headed person with mental retardation, a general physician noticed an addition of autosomal chromosome. <p> Answer the following questions. <p> a. Addition or deletion of chromosome generally results in β¦β¦β¦β¦β¦β¦β¦. <p> b. What may be the possible syndrome or disorder the above person should suspected to be? <p> c. Suggest two more morphological peculiarities to confirm the chromosome disorder in that person. </div>
<div class="answer"> <p>β
<b>Answer</b></p> a. Chromosomal disorders <p> b. Downβs syndrome <p> c. Flattened face, Simian palm crease, partially open mouth, furrowed tongue etc. </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> 13) Analyzing the relationship among different columns, fill the gap appropriately. <div class="separator" style="clear: both;"><a href="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEh_40grNbmh0Du1E6oi4S-WdGPLBDWWL2ffXy7DGYDlGwBgcseuvk29LcnmlSIMVtwacTDtN18PZIn-h6YE7EJ1KWweoo-YbtOoZskxMENivjc0XDTz4mmA0frxtLFny54dssobZcqiUqLN4Cyz8cwSrs03-Q3QGv61je_LNJ1PvC4ZWPfI8EycECO8Jcg/s1600/bob.jpg" style="display: block; padding: 1em 0; text-align: center; "><img alt="" border="0" data-original-height="204" data-original-width="589" src="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEh_40grNbmh0Du1E6oi4S-WdGPLBDWWL2ffXy7DGYDlGwBgcseuvk29LcnmlSIMVtwacTDtN18PZIn-h6YE7EJ1KWweoo-YbtOoZskxMENivjc0XDTz4mmA0frxtLFny54dssobZcqiUqLN4Cyz8cwSrs03-Q3QGv61je_LNJ1PvC4ZWPfI8EycECO8Jcg/s1600/bob.jpg"/></a></div> </div>
<div class="answer"> <p>β
<b>Answer</b></p> (a) Typhoid <p> (b) Nasal congestion & discharge <p> (c) <i>Plasmodium</i> species <p> (d) Malaria. </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> 14) A couple has 2 daughters. The blood group of husband and wife is βOβ. <p> a. What are the possible blood groups the children should have? <p> b. Whether any change in blood group will occur if they have two sons instead of daughters? Substantiate your answer. </div>
<div class="answer"> <p>β
<b>Answer</b></p> a) The children will be βOβ blood group. This is because βOβ blood type is recessive and doesnβt have any antigens. <p> b) The sex of the children does not affect their blood group. Blood group inheritance is independent of sex. So, if the couple has two sons instead of daughters, the sons would also have βOβ blood type.
</div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> 15) It is evident that, it is the genetic make-up of the sperm that determine the sex of the child in human beings. Substantiate. </div>
<div class="answer"> <p>β
<b>Answer</b></p> In humans, sex is determined by the X and Y chromosomes. Females have two X chromosomes (XX) and males have one X and one Y chromosome (XY). <p> During reproduction, a female can only pass on an X chromosome through her egg, while a male can pass on either an X or a Y chromosome through his sperm. <p> Therefore, if the sperm carries an X chromosome, the child will be female (XX). If the sperm carries a Y chromosome, the child will be male (XY). </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> 16) The below graph shows the levels of ovarian hormones in a normally menstruating woman during the follicular phase. <div class="separator" style="clear: both;"><a href="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEiquP-TG-gI1csjoGNlUiu1ACdj8fAdnCtJf3IDVk3a0XtoMYGiTz764-1mBj77quqCp2bM82shCDLrtCIqqS7IrlYDlIWvalyN2JBt74NdT7muik0nWqUsUYXskCFoDLJ1gZui861US9KCjPpgIEwSxTHa8B-vLdjmgcOjrxjTAqPw9GcC74GRrTSnosg/s1600/bob.jpg" style="display: block; padding: 1em 0; text-align: center; "><img alt="" border="0" data-original-height="180" data-original-width="235" src="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEiquP-TG-gI1csjoGNlUiu1ACdj8fAdnCtJf3IDVk3a0XtoMYGiTz764-1mBj77quqCp2bM82shCDLrtCIqqS7IrlYDlIWvalyN2JBt74NdT7muik0nWqUsUYXskCFoDLJ1gZui861US9KCjPpgIEwSxTHa8B-vLdjmgcOjrxjTAqPw9GcC74GRrTSnosg/s1600/bob.jpg"/></a></div><p> a. Name a & b. <p> b. Mention the role of pituitary hormones in maintaining this condition. </div>
<div class="answer"> <p>β
<b>Answer</b></p> a. (a) is estrogen & (b) is progesterone. <p> b. During follicular phase, pituitary gland secretes Follicle Stimulating Hormone (FSH) which stimulates the growth of ovarian follicles and secretion of estrogen. The pituitary gland also secretes Luteinizing Hormone (LH), but its level is low during this phase, resulting in low progesterone levels. </div>
<button class="answer-button">View Answer</button>
</div>
<p style="font-size: 18px; font-family: Arial; text-align: left; color: #5c5c5c; background-color: #ebeaec; padding: 10px;"> <b> <i>III. Answer any 3 questions from 17 β 20. Each carries 3 scores. (3 x 3 = 9)</i> </b> </p>
<div class="box">
<div class="question"> 17) a) Draw a flowchart showing the process of spermatogenesis. (2) <p> b) What is meant by Spermiation? (1)</div>
<div class="answer"> <p>β
<b>Answer</b></p> a) <b>Flowchart showing spermatogenesis. </b> <div class="separator" style="clear: both;"><a href="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEjDfMdoMC-t6B5LYGJWH8tRMAb9viTnH452AEyHZhAUCYqfhyRp9-c1SUPCEIXDwM6-pgP2xkNULgY2467UM47QsQLF_dV_IeOpT0N_Ctdi2Ill55Pf9SB7JUge1ZMdQiWAj0gV5nuvqSgk09XfIAV_pWBEYJhpbukvgDrbpnOaF_ILcs6eesSmMzn2Sg8/s1600/bob2.png" style="display: block; padding: 1em 0; text-align: center; "><img alt="" border="0" data-original-height="472" data-original-width="577" src="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEjDfMdoMC-t6B5LYGJWH8tRMAb9viTnH452AEyHZhAUCYqfhyRp9-c1SUPCEIXDwM6-pgP2xkNULgY2467UM47QsQLF_dV_IeOpT0N_Ctdi2Ill55Pf9SB7JUge1ZMdQiWAj0gV5nuvqSgk09XfIAV_pWBEYJhpbukvgDrbpnOaF_ILcs6eesSmMzn2Sg8/s1600/bob2.png"/></a></div> b) After spermiogenesis, sperm heads are embedded in Sertoli cells to get nourishment. Then the matured sperms are released from the seminiferous tubules. It is called spermiation. </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> 18) Categorize the given birth control methods into three groups with proper heads. <p> <center> Cervical caps, Vasectomy, CuT, Tubectomy, Diaphragms, Condoms, Lippes loop </center> </div>
<div class="answer"> <p>β
<b>Answer</b></p> Types of Contraceptives: <p> <b>Barrier Methods: </b>Cervical caps, Diaphragms, Condoms. <p> <b>Surgical Methods:</b> Vasectomy, Tubectomy. <p> <b>Intrauterine Devices (IUDs):</b> CuT, Lippes loop.
</div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> 19) βBiodiversity is the rich variety of life that makes our world a thriving and beautiful tapestry of different plants, animals, and ecosystems, working together in harmony.β <p> a. Point out the levels of diversity in nature. (1) <p> b. Give a brief description about βThe Evil Quartet.β (2) </div>
<div class="answer"> <p>β
<b>Answer</b></p> a) Genetic diversity, Species diversity & Ecological diversity. <p> b) The Evil Quartet refers to the four major causes of biodiversity losses. They are <p> β’ Habitat loss and fragmentation <p> β’ Overexploitation <p> β’ Alien species invasions <p> β’ Coextinction </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> 20) In a paternity dispute, the VNTR DNA samples of parent and child were DNA fingerprinted. The diagrammatic representation of the DNA fingerprint is shown below. <div class="separator" style="clear: both;"><a href="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEgxkxJTfV1iwsFwit8I5slKHRUcB_5-uZCfmQMit2M8Dmrrr7mvO_0I66SArR0BFj66VPnKR5Jqk7u1jcns-ZlJE1Lhk5ye-GfIvrbKfsr2pLewtAGhaT_14blT5MjWZeVo-dOC_aLnY9VKIL5f43OkW1N-Dd-NMG2n_qg_x10hu3NlJHRO65wsCDXpLuo/s1600/bob.jpg" style="display: block; padding: 1em 0; text-align: center; "><img alt="" border="0" data-original-height="177" data-original-width="234" src="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEgxkxJTfV1iwsFwit8I5slKHRUcB_5-uZCfmQMit2M8Dmrrr7mvO_0I66SArR0BFj66VPnKR5Jqk7u1jcns-ZlJE1Lhk5ye-GfIvrbKfsr2pLewtAGhaT_14blT5MjWZeVo-dOC_aLnY9VKIL5f43OkW1N-Dd-NMG2n_qg_x10hu3NlJHRO65wsCDXpLuo/s1600/bob.jpg"/></a></div> a. What is your opinion about the paternity of child? Substantiate your opinion. (1) <p> b. List down any four major steps of molecular biological procedures adopted for this. (2) </div>
<div class="answer"> <p>β
<b>Answer</b></p> a. It suggests that the individual is the biological parent of the child. DNA fingerprinting is a method for determining paternity. If the VNTR patterns of the child match the alleged parentβs patterns, it provides strong evidence of paternity. <p> b. <b>Steps of DNA fingerprinting:</b> <p> β’ Isolation of DNA. <p> β’ Digestion of DNA by restriction endonucleases. <p> β’ Separation of DNA fragments by gel electrophoresis. <p> β’ Transferring (blotting) DNA fragments to synthetic membranes such as nitrocellulose or nylon. <p> β’ Hybridization using radioactive labelled VNTR probe. <p> β’ Detection of hybridized DNA by autoradiography. </div>
<button class="answer-button">View Answer</button>
</div>
<script>
// Get all the answer buttons
const answerButtons = document.querySelectorAll('.answer-button');
// Add a click event listener to each answer button
answerButtons.forEach(button => {
button.addEventListener('click', () => {
// Get the answer section for this button
const answerSection = button.previousElementSibling;
// Toggle the answer section's visibility
answerSection.classList.toggle('visible');
// Change the button text to "Hide Answer" or "View Answer"
if (answerSection.classList.contains('visible')) {
button.textContent = 'Hide Answer';
button.classList.add('hide-answer');
} else {
button.textContent = 'View Answer';
button.classList.remove('hide-answer');
}
});
});
</script>
<html>
<head>
<style>
.special-paragraph {
margin-bottom: -10px; /* Adjust this value to reduce the space */
color: #333333;
font-family: Arial, sans-serif;
font-size: 23px;
font-weight: bold;
line-height: 1.5;
padding: 7px;
text-align: center;
border-radius: 10px;
}
.green-bg {
background-color: #ddffd9; /* Green background */
}
.blue-bg {
background-color: #b0eaff; /* Blue background */
}
</style>
</head>
<body>
<p class="special-paragraph green-bg">
<a href="https://www.bankofbiology.com/2020/10/hse-1-2-model-qp-online-exam-series.html" style="color: green;"> π Other Question Papers </a>
</p>
<p class="special-paragraph blue-bg">
<a href="https://www.bankofbiology.com/p/question-bank.html" style="color: blue;"> π Exam Special Materials </a>
</p>
</body>
</html>
<div class="blogger-post-footer"><p> Β© copyright 2024 β All rights reserved </p>
<a href=βhttps://www.bankofbiology.comβ>bankofbiology.com</a></div>Abu Raniyahttp://www.blogger.com/profile/14189496606355139812noreply@blogger.com0tag:blogger.com,1999:blog-6823671394482492613.post-18173448051289135582024-03-03T12:23:00.081+05:302024-03-09T10:05:13.974+05:30Plus Two Biology (Bot + Zoo) | Practice Model Question Paper PDF with Answer key | SET 2<!DOCTYPE html>
<html>
<head>
<title>Example Webpage</title>
<style>
body {
user-select: none; /* Prevent selection of text */
-moz-user-select: none; /* Firefox */
-webkit-user-select: none; /* Safari and Chrome */
-ms-user-select: none; /* Internet Explorer/Edge */
}
h1 {
user-select: text; /* Allow selection of title */
}
</style>
</head>
<p style="font-size: 25px; font-family: Arial; text-align: center; color: #2068d4; line-height: 1.5;"> <b> π <a href="https://drive.google.com/file/d/1CnJwXF-Qm7HOJ6AlXdRnRVK0_ba461lA/view?usp=sharing" target="_blank">Download Biology Question Paper PDF - SET 2</a> </b> </p>
<p style="font-size: 30px; font-family: Arial; text-align: center; color: #0c8a7d; background-color: #a2f5d3; padding: 10px;"> <b> PART A: BOTANY </b></p>
<style>
/* Customize the box style */
.box {
background-color: #ffffff;
border: 1px solid #ffffff;
border-radius: 1px;
padding: 10px;
margin-bottom: 10px;
margin-right: -14px;
margin-left: -14px;
}
/* Customize the question style */
.question {
font-size: 17px;
font-weight: bold;
color: #3d454a;
font-family: Open Sans;
margin-bottom: 10px;
}
/* Customize the answer style */
.answer {
font-size: 18px;
font-weight: normal;
font-family: Roboto;
margin-bottom: 10px;
background-color: #e7ffde;
}
/* Hide the answer by default */
.answer {
display: none;
}
/* Customize the view/hide answer button */
.answer-button {
background-color: #4CAF50;
border: none;
border-radius: 5px;
color: white;
padding: 8px 16px;
text-align: center;
text-decoration: none;
display: inline-block;
font-size: 18px;
margin-bottom: 1px;
cursor: pointer;
}
/* Style the button differently when it changes to "Hide Answer" */
.answer-button.hide-answer {
background-color: #f44336;
}
/* Show the answer when the visible class is added */
.answer.visible {
display: block;
}
.table-text {
display: grid;
grid-template-columns: 50% 50%;
grid-gap: none;
margin-top: 5px;
border-collapse: collapse;
}
.table-text-2 {
display: grid;
grid-template-columns: 33.33% 33.33% 33.33%;
grid-gap: none;
margin-top: 5px;
border-collapse: collapse;
}
.table-text-header,
.table-text-cell {
padding: 5px;
border: 1px solid black;
}
.table-text-header {
font-weight: bold;
text-align: center;
}
.no-break {
white-space: nowrap;
}
.tab {
text-indent: 40px; /* Adjust the value as per your preference */
}
</style>
<p style="font-size: 18px; font-family: Arial; text-align: left; color: #5c5c5c; background-color: #ebeaec; padding: 10px;"> <b> <i>I. Answer any 3 questions from 1 β 5. Each carries 1 score. (3 x 1 = 3)</i> </b> </p>
<div class="box">
<div class="question">1) Name the first transgenic cow that produces human protein enriched milk. </div>
<div class="answer"><p>β
Rosie. </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question">2) Name the principle which states that two closely related species competing for the same resources cannot co-exist indefinitely and the competitively inferior one will be eliminated eventually. </div>
<div class="answer"><p>β
Gauseβs βCompetitive Exclusion Principleβ. </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question">3) The first discovered <i>restriction endonuclease</i> is β¦β¦β¦β¦β¦β¦β¦β¦ </div>
<div class="answer"><p>β
Hind II </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> 4) Vertical distribution of different species occupying different levels is called β¦β¦β¦β¦β¦β¦β¦β¦ </div>
<div class="answer"> <p>β
Stratification. </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question">5) Microsporangium is surrounded by four wall layers. Name the layer which nourishes developing pollen grains. </div>
<div class="answer"><p>β
Tapetum </div>
<button class="answer-button">View Answer</button>
</div>
<p style="font-size: 18px; font-family: Arial; text-align: left; color: #5c5c5c; background-color: #ebeaec; padding: 10px;"> <b> <i>II. Answer any 9 questions from 6 β 16. Each carries 2 scores. (9 x 2 = 18)</i> </b> </p>
<div class="box">
<div class="question"> 6) Bt. Cotton is a well-known example of application of Biotechnology in Agriculture. Bt. Cotton reduces use of pesticides. Explain. </div>
<div class="answer"> <p>β
<b>Answer</b></p> Bt. Cotton is genetically modified to produce a natural insecticide, the Bt toxin, derived from the bacterium <i>Bacillus thuringiensis.</i> This makes the cotton plant resistant to certain pests, reducing the need for chemical pesticides. </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> 7) Anitha is studying about a circular DNA which has the following sequence. <p>5β β GGAATTCC β 3β<br>3β β CCTTAAGG β 5β <p>She wishes to add a new segment of DNA into it. <p> a. Identify the technology she planned. <br> b. Suggest the specific enzyme to make a cut in the DNA with above sequence. </div>
<div class="answer"> <p>β
<b>Answer</b></p> a. Recombinant DNA technology. <p> b. A restriction enzyme called EcoRI. </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> 8) <i>Adenosine deaminase (ADA)</i> deficiency is a hereditary disease where ADA which is crucial for functioning of immune system is absent. Explain how ADA deficiency can be treated. </div>
<div class="answer"> <p>β
<b>Answer</b></p> ADA deficiency can be treated through enzyme replacement therapy or gene therapy. <p> In enzyme replacement therapy, patients receive regular injections of functional ADA enzyme. <p> In gene therapy, a functional ADA gene is introduced into the patient's cells, restoring the production of ADA enzyme.
</div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> 9) Density of a population in a given habitat during a given period fluctuates due to changes in 4 basic processes- Natality, Mortality, Immigration & Emigration. <p> a. Differentiate Natality and Mortality. <br> b. Differentiate Immigration & Emigration. </div>
<div class="answer"> <p>β
<b>Answer</b></p> (a) <b>Natality (B):</b> It is the number of births in a population during a given period. <br> <b>Mortality (D):</b> It is the number of deaths in a population during a given period. <p> (b) <b>Immigration (I):</b> It is the number of individuals of the same species that have come into the habitat from elsewhere during a given time period. <br> <b>Emigration (E):</b> It is the number of individuals of the population who left the habitat and gone elsewhere during a given time period. </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> 10) Match the following: <div class="separator" style="clear: both;"><a href="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEgBwvsYxIvO6ZaVStT6okRxfuytQk56H-5gTiCfHM-BIrIpgy7FC3_Y8sS5UhtJZ4j0Yhj-Uzcyi0vJ1eZamqmXdX6d0NilutcAhZZnJWDdbauPyS3DI_23iHGg-UY9OIB9UPaF1gp336nLGB17rQ-4ZoF82bHwmKexUq2URtKt_HFTUard5YKkTuUugPI/s1600/bob.jpg" style="display: block; padding: 1em 0; text-align: center; "><img alt="" border="0" data-original-height="274" data-original-width="550" src="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEgBwvsYxIvO6ZaVStT6okRxfuytQk56H-5gTiCfHM-BIrIpgy7FC3_Y8sS5UhtJZ4j0Yhj-Uzcyi0vJ1eZamqmXdX6d0NilutcAhZZnJWDdbauPyS3DI_23iHGg-UY9OIB9UPaF1gp336nLGB17rQ-4ZoF82bHwmKexUq2URtKt_HFTUard5YKkTuUugPI/s1600/bob.jpg"/></a></div> </div>
<div class="answer"> <p>β
<b>Answer</b></p> <div class="separator" style="clear: both;"><a href="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEhyxOi4sSKQ6oQKmcTKdYJHzQ1JH-En7t_8YtWNgOTzdE6ladaaAqfDzQS6k81T4HBTtNc5hddTkvu31vp35yS1LT4xqbvRnVP3wuoAzlJCBV7xX52Ou0aeh8DQwrtESZ-DYZgiNDyafUCgwx4hpcU7PXzS3XMTnkF8VtdUGidnMxb2-kdqXcjv_Rn-xDo/s1600/bob.jpg" style="display: block; padding: 1em 0; text-align: center; "><img alt="" border="0" data-original-height="190" data-original-width="531" src="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEhyxOi4sSKQ6oQKmcTKdYJHzQ1JH-En7t_8YtWNgOTzdE6ladaaAqfDzQS6k81T4HBTtNc5hddTkvu31vp35yS1LT4xqbvRnVP3wuoAzlJCBV7xX52Ou0aeh8DQwrtESZ-DYZgiNDyafUCgwx4hpcU7PXzS3XMTnkF8VtdUGidnMxb2-kdqXcjv_Rn-xDo/s1600/bob.jpg"/></a></div> </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> 11) Pond is a self-sustainable unit. Some organisms related to pond ecosystem is listed below: <p> <center>Tadpole, fish, water, plants, kingfisher </center> <p> a. Construct a food chain with the listed organisms. <br> b. Point out trophic level of each organism in the constructed food chain.
</div>
<div class="answer"> <p>β
<b>Answer</b></p> a. Plants β Tadpole β Fish β Kingfisher <p> b. <b>Trophic levels of each organism:</b> <p> <b>Plants: </b>Trophic Level 1 (Producers) <br> <b>Tadpole:</b> Trophic Level 2 (Primary Consumers) <br><b> Fish: </b>Trophic Level 3 (Secondary Consumers) <br> <b>Kingfisher:</b> Trophic Level 4 (Tertiary Consumers) </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> 12) Two students, Unni and Kannan studied inter-specific interactions between different species. Can you help them by naming the interaction between species in different cases? <div class="separator" style="clear: both;"><a href="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEg1R1utMoDdH7xhXf297yo8dxcYKAK8baukK7vuCDWzy0c7ajhUF_Q3z_9dFHty7clBK7ACOqT9Eg9CM04BwaZ_qcB4A0fB9H14j5QDdrECQ5EbkrlkleOpjG3E_kVdsy4XtLeXQ279YTBwvv6DfMSNOXekcT4waJzBAnBZzsL_jHFkT9yATBH2Nnh3lJw/s1600/bob.jpg" style="display: block; padding: 1em 0; text-align: center; "><img alt="" border="0" data-original-height="175" data-original-width="523" src="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEg1R1utMoDdH7xhXf297yo8dxcYKAK8baukK7vuCDWzy0c7ajhUF_Q3z_9dFHty7clBK7ACOqT9Eg9CM04BwaZ_qcB4A0fB9H14j5QDdrECQ5EbkrlkleOpjG3E_kVdsy4XtLeXQ279YTBwvv6DfMSNOXekcT4waJzBAnBZzsL_jHFkT9yATBH2Nnh3lJw/s1600/bob.jpg"/></a></div></div>
<div class="answer"> <p>β
<b>Answer</b></p> <b>Case No. 1:</b> Mutualism <br> <b>Case No. 2:</b> Competition <br> <b>Case No. 3:</b> Predation/Parasitism <br> Case No. 4: Commensalism </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> 13) The given figure represents the reactions associated with PCR. <p> a. Expand PCR. <br> b. Name the steps A, B, C in the process. <div class="separator" style="clear: both;"><a href="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEhYD1I64UoIdDj5ghiv1YCMNb7VlTaLtYs6PQsQmqOvpHNsQnzCxPTwn0l4mVSJapLaT53cGDpOixC6fCryRsdBpF4shiWQgTFNalFdiElGDpa0i23dAdQ7U58-FYsGVhw1s_5NKKPUJTawSciJZdmTLv3MGpldwankpeLUZLnuLS3M-wD_sdQIAGs0yGk/s1600/Picture1.jpg" style="display: block; padding: 1em 0; text-align: center; "><img alt="" border="0" data-original-height="644" data-original-width="640" src="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEhYD1I64UoIdDj5ghiv1YCMNb7VlTaLtYs6PQsQmqOvpHNsQnzCxPTwn0l4mVSJapLaT53cGDpOixC6fCryRsdBpF4shiWQgTFNalFdiElGDpa0i23dAdQ7U58-FYsGVhw1s_5NKKPUJTawSciJZdmTLv3MGpldwankpeLUZLnuLS3M-wD_sdQIAGs0yGk/s1600/Picture1.jpg"/></a></div>
</div>
<div class="answer"> <p>β
<b>Answer</b></p> (a) Polymerase Chain Reaction. <p> (b) <b>Steps:</b> <p> A= Denaturation <br> B= Annealing <br> C= Extension </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> 14) Correct the following statements considering the underlined part. <p> a. Ovary develops into seed. <br> b. In flowering plants, zygote is formed inside the microsporangium. <br> c. Ovules develop into fruit. <br> d. Primary endosperm cell (PEC) develops into embryo. </div>
<div class="answer"> <p>β
<b>Answer</b></p> a. Ovary develops into fruit. <br> b. In flowering plants, zygote is formed inside the ovule. <br> c. Ovaries develop into fruit. <br> d. Zygote develops into embryo. </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> 15) Population growth may be exponential or logistic. Differentiate between them. </div>
<div class="answer"> <p>β
<b>Answer</b></p> <b>Exponential Growth:</b> <p> β’ Population increases at a constant rate. <br> β’ Unrestricted growth under ideal conditions. <br> β’ Shown by a J-shaped curve. <p> <b>Logistic Growth:</b> <p> β’ Population growth slows as it approaches carrying capacity. <br> β’ Limited resources cause a plateau in growth.<br> β’ Shown by an S-shaped curve. </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> 16) Given below a schematic representation with circles and squares which shows four factors/processes influence the population density. Write the factors in circles and squares. <div class="separator" style="clear: both;"><a href="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEjdgClH7-wLZarguvZM2OptOX47mWqbQAiIYlsdZUrV4a9fV7M4WIr1SK5qtC3i2CSClJMr14bhnnD1Y59GQsgM0f8Hz_DEK8bcKkqICoA83u9DAstZDow_ohyphenhyphen90BRbS_pG2V4Mch5UuYS8JHGFnXrr_yMBwnWwwt8kjRGYQb77HFpJ65-jDz_VnlIRm0Q/s1600/Picture1.jpg" style="display: block; padding: 1em 0; text-align: center; "><img alt="" border="0" data-original-height="224" data-original-width="338" src="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEjdgClH7-wLZarguvZM2OptOX47mWqbQAiIYlsdZUrV4a9fV7M4WIr1SK5qtC3i2CSClJMr14bhnnD1Y59GQsgM0f8Hz_DEK8bcKkqICoA83u9DAstZDow_ohyphenhyphen90BRbS_pG2V4Mch5UuYS8JHGFnXrr_yMBwnWwwt8kjRGYQb77HFpJ65-jDz_VnlIRm0Q/s1600/Picture1.jpg"/></a></div> </div>
<div class="answer"> <p>β
<b>Answer</b></p> <div class="separator" style="clear: both;"><a href="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEgZ-B5RsaypFnoQCLwcpkfW-jWnmKAUcs_8KPbeDzex035DrM1IX9CJLthsnzwGo516236hEKSgOpppNoWRUdEiFMJZt-mn_D4JENoS5bSBzafaZkJ3QZ3wtOG3PBvqe8ZAtGCh93H88DoExLm1965S-rvmiq8eu7vw_OhJaURlrUiK2RaDxZtsT_y2vQE/s1600/bob.jpg" style="display: block; padding: 1em 0; text-align: center; "><img alt="" border="0" data-original-height="262" data-original-width="547" src="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEgZ-B5RsaypFnoQCLwcpkfW-jWnmKAUcs_8KPbeDzex035DrM1IX9CJLthsnzwGo516236hEKSgOpppNoWRUdEiFMJZt-mn_D4JENoS5bSBzafaZkJ3QZ3wtOG3PBvqe8ZAtGCh93H88DoExLm1965S-rvmiq8eu7vw_OhJaURlrUiK2RaDxZtsT_y2vQE/s1600/bob.jpg"/></a></div> </div>
<button class="answer-button">View Answer</button>
</div>
<p style="font-size: 18px; font-family: Arial; text-align: left; color: #5c5c5c; background-color: #ebeaec; padding: 10px;"> <b> <i>III. Answer any 3 questions from 17 β 20. Each carries 3 scores. (3 x 3 = 9)</i> </b> </p>
<div class="box">
<div class="question"> 17) (a) While learning trophic levels in class-room, teacher asked you to explain βstanding cropβ. Explain. <p> (b) Distinguish between mutualism and parasitism. Give one example for each. </div>
<div class="answer"> <p>β
<b>Answer</b></p> (a) The amount of living material in a trophic level at a given time is called standing crop. It is measured as the biomass (mass of living organisms) or the number in a unit area. <p> (b) <b>Mutualism and parasitism.</b> <p> β’ <b>Mutualism:</b> Itβs a type of symbiotic relationship where both species benefit. E.g., bees and flowers. Bees get nectar from flowers, and in return, they help in pollination. <br> β’ <b>Parasitism:</b> Itβs a type of symbiotic relationship where one species (the parasite) benefits at the expense of the other (the host). E.g., Ticks feed on the dogβs blood. </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> 18) Raju is a diabetic patient who takes insulin injections regularly. The insulin used by such patients is produced by genetically engineered organisms. Write different steps involved in the production of insulin by genetic engineering. </div>
<div class="answer"> <p>β
<b>Answer</b></p> In 1983, <i>Eli Lilly</i> company prepared two DNA sequences corresponding to A & B chains of human insulin and introduced them in plasmids of <i>E. coli</i> to produce insulin chains. Chains A & B were combined by creating disulfide bonds to form <b>human insulin (Humulin).</b> <p> β’ The human insulin gene is isolated from a human cell. <br> β’ The insulin gene is inserted into a plasmid of <i>E. coli</i> to form a recombinant DNA. <br> β’ Recombinant DNA plasmid is introduced into <i>E. coli</i>. <br> β’ <i>E. coli</i> multiply and produce insulin. <br> β’ Insulin is extracted and purified for medical use. <br> </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> 19) Three different ο¬owers are given. <p> (i) Maize (ii) <i>Vallisneria</i> (iii) Rose <p> a) Group them based on pollinating agents. <br> b) Mention one adaptation of each ο¬ower related with the agents of pollination. </div>
<div class="answer"> <p>β
<b>Answer</b></p> a) <b>Grouping based on pollinating agents:</b> <p> β’ Maize: Wind Pollinated (Anemophily) <br> β’ Vallisneria: Water Pollinated (Hydrophily) <br> β’ Rose: Insect Pollinated (Entomophily) <p> b) <b>Adaptations related to pollination:</b> <p> β’ Maize: It has long and feathery stigmas to catch pollen grains from the wind. <br> β’ Vallisneria: It has long stalked female flowers that reach the water surface to catch pollen grains. <br> β’ Rose: It has bright colour and sweet fragrance to attract insects. </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> 20) Diagram shows a typical agarose gel showing migration of DNA fragments. <div class="separator" style="clear: both;"><a href="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEg1ai9kgrtRVJjCCSaDyGKHCTp_XsL_WweWrrFHNQojakk0XywblhuKMnqLtkYU2PpKMmBNssZsO3Qwh9V2k-eqMw5tyL2wGQJ4CMkBcsXU3meE5af6lOMNjMFFoS1I0uqU_5xVD6H01PCD1TRgyavpipzPz8ikQHB87bgZqJJ8-PFBbonqAEait-AE3js/s1600/bob.jpg" style="display: block; padding: 1em 0; text-align: center; "><img alt="" border="0" data-original-height="157" data-original-width="470" src="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEg1ai9kgrtRVJjCCSaDyGKHCTp_XsL_WweWrrFHNQojakk0XywblhuKMnqLtkYU2PpKMmBNssZsO3Qwh9V2k-eqMw5tyL2wGQJ4CMkBcsXU3meE5af6lOMNjMFFoS1I0uqU_5xVD6H01PCD1TRgyavpipzPz8ikQHB87bgZqJJ8-PFBbonqAEait-AE3js/s1600/bob.jpg"/></a></div> a. Which of the bands has largest and smallest DNA fragments? <br> b. How can you make fragments of DNA for electrophoresis? <br> c. Explain separation of DNA fragments using electrophoresis.
</div>
<div class="answer"> <p>β
<b>Answer</b></p> (a) a is largest DNA fragments and e is smallest DNA fragments. <p> (b) DNA is fragmented using restriction endonucleases that cut DNA at specific sequences. <p> (c) DNA fragments are loaded into agarose gel, and an electric current is applied. DNA is negatively charged, so it moves towards the anode. Smaller fragments move faster while larger fragments move slower and travel less distance. This results in separation of DNA fragments based on size.
</div>
<button class="answer-button">View Answer</button>
</div>
<p style="font-size: 30px; font-family: Arial; text-align: center; color: #993d77; background-color: #ffe0f4; padding: 10px;"> <b> PART B: ZOOLOGY </b></p>
<p style="font-size: 18px; font-family: Arial; text-align: left; color: #5c5c5c; background-color: #ebeaec; padding: 10px;"> <b> <i>I. Answer any 3 questions from 1 β 5. Each carries 1 score. (3 x 1 = 3)</i> </b> </p>
<div class="box">
<div class="question">1) The gene flow by chance causing change in frequency is called ................... </div>
<div class="answer"><p>β
Genetic drift </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question">2) Name the process of differentiation of spermatids to spermatozoa. </div>
<div class="answer"><p>β
Spermiogenesis </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question">3) Ovulation occurs on ............... of the Menstrual cycle. <p>(a) 10<sup>th</sup> day (b) 14<sup>th</sup> day <br>(c) 1-5<sup>th</sup> day (d) 15-28<sup>th</sup> day </div>
<div class="answer"><p>β
(b) 14<sup>th</sup> day </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> 4) Who popularized the term Biodiversity? </div>
<div class="answer"> <p>β
Edward Wilson </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question">5) Swiss cheese has large holes due to production of CO2 by a bacterium called ................ </div>
<div class="answer"><p>β
<i>Propionibacterium sharmani</i> </div>
<button class="answer-button">View Answer</button>
</div>
<p style="font-size: 18px; font-family: Arial; text-align: left; color: #5c5c5c; background-color: #ebeaec; padding: 10px;"> <b> <i>II. Answer any 9 questions from 6 β 16. Each carries 2 scores. (9 x 2 = 18)</i> </b> </p>
<div class="box">
<div class="question"> 6) a) Expand BAC and YAC. <br> b) Mention any two salient features of human genome. </div>
<div class="answer"> <p>β
<b>Answer</b></p> (a) BAC: Bacterial Artificial Chromosome <br>YAC: Yeast Artificial Chromosome <p> (b) <b>Salient features of human genome:</b> <p> β’ Human genome contains 3164.7 million nucleotide bases. <br> β’ Total number of genes= about 30,000. <br> β’ Average gene consists of 3000 bases, but sizes vary. <br> β’ 99.9% nucleotide bases are same in all people. Only 0.1% difference makes every individual unique. </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> 7) Observe the figure given below: <div class="separator" style="clear: both;"><a href="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEgFrCHrtCS7EDybx-uFCrb-9OusYVgL2QJX_NnOnttUJ3b6lcxfpy4cwUvHGsFJlmBKz5GSLdOpPLYALhlE48qvoWXR_MfN7y-AcT3l5vwVutrcG1rp94k-SUDk3BBAH8bNlHRDw7XgYu6u6CDrkJPw4rRSRG6XdED5eC1NLneRo7vQ4-_ARFUhXdCDFkw/s447/bob.jpg" style="display: block; padding: 1em 0; text-align: center; "><img alt="" border="0" height="320" data-original-height="447" data-original-width="169" src="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEgFrCHrtCS7EDybx-uFCrb-9OusYVgL2QJX_NnOnttUJ3b6lcxfpy4cwUvHGsFJlmBKz5GSLdOpPLYALhlE48qvoWXR_MfN7y-AcT3l5vwVutrcG1rp94k-SUDk3BBAH8bNlHRDw7XgYu6u6CDrkJPw4rRSRG6XdED5eC1NLneRo7vQ4-_ARFUhXdCDFkw/s320/bob.jpg"/></a></div>(a) Identify the disorder and its genetic constitution. <br>(b) Write any two symptoms of this disorder.
</div>
<div class="answer"> <p>β
<b>Answer</b></p> (a) Turnerβs syndrome. Genetic constitution: 44A + X0 <br>(b) Sterile, Ovaries are rudimentary. Lack of secondary sexual characters. Dwarf. Mentally retarded (Any 2).
</div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> 8) (a) βMicrobes can be used for energy purposesβ. Do you agree? Justify. <br> (b) Name any two microbes used as biofertilizers.
</div>
<div class="answer"> <p>β
<b>Answer</b></p> (a) Yes. <i>Methanogens</i> are the microbes that can be used for biogas production. <br> (b) <i>Rhizobium</i>, <i>Azotobacter</i>, Cyanobacterium, Mycorrhiza etc. (any 2)
</div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> 9) Match the following: <div class="separator" style="clear: both;"><a href="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEgHhnwEVKZ5-2uZzL4ZaZcdu-QGDJyyz2XBHl83ACiSR0WW_foGqmh_HTA3dSYK6XQjygLeZINLYUjZ1bHi0jtgNgT4WfDbPAR-jLlyFEUArUudDGLaiXBdLd1CAqeHpBwORjFjs0p_YcAxP9qtyC7CBSqzmqfgAQ9YB6d6z1WbtV2VLAxoaUMBu0GzaHI/s1600/bob.jpg" style="display: block; padding: 1em 0; text-align: center; "><img alt="" border="0" data-original-height="183" data-original-width="477" src="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEgHhnwEVKZ5-2uZzL4ZaZcdu-QGDJyyz2XBHl83ACiSR0WW_foGqmh_HTA3dSYK6XQjygLeZINLYUjZ1bHi0jtgNgT4WfDbPAR-jLlyFEUArUudDGLaiXBdLd1CAqeHpBwORjFjs0p_YcAxP9qtyC7CBSqzmqfgAQ9YB6d6z1WbtV2VLAxoaUMBu0GzaHI/s1600/bob.jpg"/></a></div></div>
<div class="answer"> <p>β
<b>Answer</b></p> <div class="separator" style="clear: both;"><a href="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEhT1-2DKbEKt67O_Rzid2VmiZZAoLFPRAeeCAwmVy9hd3aMpJjGXNTdoVBj_MDbbUxBH7O3oK-i_j6H6lU63AJ1BvYlHMnoUVf9oN1l4cKvvXNDeHNRQk80WWyJrXrFcQuT8V5iSDkLQG7c2c4ipwgL2idHp44lNWo_4MPlSU_tLWuFCS9PgoUD5MkpRHI/s1600/bob.jpg" style="display: block; padding: 1em 0; text-align: center; "><img alt="" border="0" data-original-height="174" data-original-width="480" src="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEhT1-2DKbEKt67O_Rzid2VmiZZAoLFPRAeeCAwmVy9hd3aMpJjGXNTdoVBj_MDbbUxBH7O3oK-i_j6H6lU63AJ1BvYlHMnoUVf9oN1l4cKvvXNDeHNRQk80WWyJrXrFcQuT8V5iSDkLQG7c2c4ipwgL2idHp44lNWo_4MPlSU_tLWuFCS9PgoUD5MkpRHI/s1600/bob.jpg"/></a></div> </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> 10) Observe the diagram given. <div class="separator" style="clear: both;"><a href="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEjlowqcUdun2D0JVp5U_4TG0s0s1hUvJLBte0B-rTB1lrHht2KwjsJ-OYzgU4Qs6xyqwnTJ1tpw4nyRLM96a-tiBTBVbRopAVYXk34BjsiH10P-8Eo05FLu4JTSZWYCjWOPLztrQdUqBH9SFonk_YSuXaCtSpyzquZH2N4-DqwEhXU2pucsoq1D4ZoAmLg/s1600/bob.jpg" style="display: block; padding: 1em 0; text-align: center; "><img alt="" border="0" data-original-height="320" data-original-width="404" src="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEjlowqcUdun2D0JVp5U_4TG0s0s1hUvJLBte0B-rTB1lrHht2KwjsJ-OYzgU4Qs6xyqwnTJ1tpw4nyRLM96a-tiBTBVbRopAVYXk34BjsiH10P-8Eo05FLu4JTSZWYCjWOPLztrQdUqBH9SFonk_YSuXaCtSpyzquZH2N4-DqwEhXU2pucsoq1D4ZoAmLg/s1600/bob.jpg"/></a></div>a. Identify the molecule. Which cell produces this? <br> b. Mention its importance.
</div>
<div class="answer"> <p>β
<b>Answer</b></p> (a) An antibody. It is produced by B-lymphocytes (B-cells). <br>(b) These are the proteins to fight the pathogens. i.e., gives immunity. </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> 11) (a) Briefly explain the theory of Abiogenesis. <br>(b) Who experimentally disproved this theory? </div>
<div class="answer"> <p>β
<b>Answer</b></p> (a) It states that life came out of decaying and rotting matter like straw, mud etc. <br> (b) Louis Pasteur disproved this theory.
</div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> 12) Write down the single word for the following. <p>a. Blastocyst becomes embedded in the endometrium. <br>b. Mammary glands produce milk towards the end of pregnancy. <br>c. Cap-like structure at the tip of sperm head. <br>d. Yellow-coloured structure developed from ruptured Graafian follicle after ovulation. </div>
<div class="answer"> <p>β
<b>Answer</b></p> (a) Implantation <br>(b) Lactation <br> (c) Acrosome <br>(d) Corpus luteum
</div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> 13) Expand: (i) GIFT (ii) ICSI </div>
<div class="answer"> <p>β
<b>Answer</b></p> (i) GIFT: Gamete Intra Fallopian Transfer <br> (ii) ICSI: Intra Cytoplasmic Sperm Injection </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> 14) Distinguish between divergent evolution and convergent evolution. </div>
<div class="answer"> <p>β
<b>Answer</b></p> <b>Divergent evolution:</b> It is the evolution by which related species become less similar to survive and adapt in different environmental condition. <br> <b>Convergent evolution:</b> It is the evolution by which unrelated species become more similar to survive and adapt in similar environmental condition. </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> 15) Write down any 4 salient features of genetic code. </div>
<div class="answer"> <p>β
<b>Answer</b></p> Salient features of genetic code: <p> β’ Triplet code. 61 codons code for amino acids. UAA, UAG & UGA are stop codons (Termination codons). <br>β’ Genetic code is universal. <br> β’ No punctuations b/w adjacent codons. <br> β’ An amino acid is coded by many codons. So the code is degenerate. </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> 16) To find out the unknown genotype of violet flowered pea plant, a researcher done the following cross. Observe the diagram and answer the following questions. <div class="separator" style="clear: both;"><a href="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEhjozDU4YVrAk25scns9JzJFdQ0zIbnDz0r8C2DbhCUlRBXwj8TRHUgzWE_-VD9xdP5MQ_zZ-PIL8CyQfudYuVH7Kj1EtWlkqYWNkU507Yrad8x5Y10FVL-IG6EG3HR0l_iDiKgMcrRDufmJFpTSuYmP8oHxVHvVRO4UkkaQ622pHmpQM913Y7iwYyUurQ/s1600/bob.jpg" style="display: block; padding: 1em 0; text-align: center; "><img alt="" border="0" data-original-height="335" data-original-width="436" src="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEhjozDU4YVrAk25scns9JzJFdQ0zIbnDz0r8C2DbhCUlRBXwj8TRHUgzWE_-VD9xdP5MQ_zZ-PIL8CyQfudYuVH7Kj1EtWlkqYWNkU507Yrad8x5Y10FVL-IG6EG3HR0l_iDiKgMcrRDufmJFpTSuYmP8oHxVHvVRO4UkkaQ622pHmpQM913Y7iwYyUurQ/s1600/bob.jpg"/></a></div>a. What would be the above cross is called? Define it. <br> b. Mention its significance. </div>
<div class="answer"> <p>β
<b>Answer</b></p> (a) Test cross. It is the cross between F1 hybrid with a recessive parent. <br> (b) It is used to find out the unknown genotype of a character. </div>
<button class="answer-button">View Answer</button>
</div>
<p style="font-size: 18px; font-family: Arial; text-align: left; color: #5c5c5c; background-color: #ebeaec; padding: 10px;"> <b> <i>III. Answer any 3 questions from 17 β 20. Each carries 3 scores. (3 x 3 = 9)</i> </b> </p>
<div class="box">
<div class="question"> 17) Understanding the warning signs of drug/alcohol abuse is important to save the people in Adolescence period. <p> a. Mention any three such warning signs. <br> b. Mention any three ways for prevention and control of drug/alcohol abuse. </div>
<div class="answer"> <p>β
<b>Answer</b></p> (a) <b>Warning signs:</b> <p> β’ Drop in academic performance and absence from school. <br> β’ Lack of interest in personal hygiene. <br> β’ Withdrawal and isolation. <br> β’ Depression, fatigue, aggressive and rebellious behaviour. <br> β’ Change in sleeping and eating habits. <p> (b) <b>Prevention and control:</b> <br> β’ Avoid undue peer pressure. <br> β’ Education and counselling. <br> β’ Seeking help from parents and peers. <br> β’ Looking for danger signs. <br> β’ Seeking professional and medical help. </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> 18) T.H Morgan conducted some experiments using <i>Drosophila melanogaster</i> and made important observations regarding linkage and recombination. <p> a. Define linkage and recombination. <br> b. Mention his any two conclusions from this experiment. </div>
<div class="answer"> <p>β
<b>Answer</b></p> (a) Linkage is the physical association of genes on a chromosome. <br> Recombination is the generation of non-parental gene combinations. <p>(b) He found that <br> β’ When two genes were situated on same chromosome, proportion of parental gene combinations was much higher than the non-parental type. It is due to linkage. <br> β’ Genes of white eye & yellow body were very tightly linked and showed only 1.3% recombination. <br> β’ Genes of white eye & miniature wing were loosely linked and showed 37.2% recombination. <br> β’ Tightly linked genes show low recombination. Loosely linked genes show high recombination. </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> 19) (a) Mention any two examples for co-extinction. <br> (b) Biodiversity (species richness) is highest in tropics. Give any two reasons. <br> (c) Define the term hotspots. </div>
<div class="answer"> <p>β
<b>Answer</b></p> (a) Extinction of the parasites when the host is extinct. <br> In co-evolved plant-pollinator mutualism, extinction of one causes the extinction of the other. <p> (b) Biodiversity (species richness) is highest in tropics because <p> β’ Tropics had more evolutionary time. <br> β’ Relatively constant environment (less seasonal). <br> β’ They receive more solar energy which contributes to greater productivity. <p> (c) Hotspots are the regions with very high species richness, high degree of endemism but most threatened. </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> 20) (a) Prepare a flowchart showing the Central Dogma of Molecular Biology. <br> (b) Name the initiator codon and the amino acid coded by it. </div>
<div class="answer"> <p>β
<b>Answer</b></p> (a) Central Dogma of Molecular Biology: <div class="separator" style="clear: both;"><a href="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEjcDXVZF0wMcU85zVxMAxZ03Cq3OgOSPVjWwdlYx-vqdXfuzEFHH11Xnu67HAX1LDopiW_0HZ_xkE7cgp4QfmexjLl9wI9n68_zGC3rDDtI2spAoWrIXCZZ5L9cZIzhLeT6EFA_ZJ4bnHyTWwOXoRDLTkaOlEr16j4pDGQj8-6jFMzfUVeqYQPC1Gth8VM/s1600/bob.jpg" style="display: block; padding: 1em 0; text-align: center; "><img alt="" border="0" data-original-height="230" data-original-width="1309" src="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEjcDXVZF0wMcU85zVxMAxZ03Cq3OgOSPVjWwdlYx-vqdXfuzEFHH11Xnu67HAX1LDopiW_0HZ_xkE7cgp4QfmexjLl9wI9n68_zGC3rDDtI2spAoWrIXCZZ5L9cZIzhLeT6EFA_ZJ4bnHyTWwOXoRDLTkaOlEr16j4pDGQj8-6jFMzfUVeqYQPC1Gth8VM/s1600/bob.jpg"/></a></div>(b) AUG is the initiator codon. Methionine is the amino acid coded by it.
</div>
<button class="answer-button">View Answer</button>
</div>
<script>
// Get all the answer buttons
const answerButtons = document.querySelectorAll('.answer-button');
// Add a click event listener to each answer button
answerButtons.forEach(button => {
button.addEventListener('click', () => {
// Get the answer section for this button
const answerSection = button.previousElementSibling;
// Toggle the answer section's visibility
answerSection.classList.toggle('visible');
// Change the button text to "Hide Answer" or "View Answer"
if (answerSection.classList.contains('visible')) {
button.textContent = 'Hide Answer';
button.classList.add('hide-answer');
} else {
button.textContent = 'View Answer';
button.classList.remove('hide-answer');
}
});
});
</script>
<html>
<head>
<style>
.special-paragraph {
margin-bottom: -10px; /* Adjust this value to reduce the space */
color: #333333;
font-family: Arial, sans-serif;
font-size: 23px;
font-weight: bold;
line-height: 1.5;
padding: 7px;
text-align: center;
border-radius: 10px;
}
.green-bg {
background-color: #ddffd9; /* Green background */
}
.blue-bg {
background-color: #b0eaff; /* Blue background */
}
</style>
</head>
<body>
<p class="special-paragraph green-bg">
<a href="https://www.bankofbiology.com/2020/10/hse-1-2-model-qp-online-exam-series.html" style="color: green;"> π Other Question Papers </a>
</p>
<p class="special-paragraph blue-bg">
<a href="https://www.bankofbiology.com/p/question-bank.html" style="color: blue;"> π Exam Special Materials </a>
</p>
</body>
</html>
<div class="blogger-post-footer"><p> Β© copyright 2024 β All rights reserved </p>
<a href=βhttps://www.bankofbiology.comβ>bankofbiology.com</a></div>Abu Raniyahttp://www.blogger.com/profile/14189496606355139812noreply@blogger.com0tag:blogger.com,1999:blog-6823671394482492613.post-27514782524074449742024-03-02T11:07:00.014+05:302024-03-09T10:02:48.527+05:30Plus Two Biology (Bot + Zoo) | Practice Model Question Paper PDF with Answer key | SET 1<!DOCTYPE html>
<html>
<head>
<title>Example Webpage</title>
<style>
body {
user-select: none; /* Prevent selection of text */
-moz-user-select: none; /* Firefox */
-webkit-user-select: none; /* Safari and Chrome */
-ms-user-select: none; /* Internet Explorer/Edge */
}
h1 {
user-select: text; /* Allow selection of title */
}
</style>
</head>
<p style="font-size: 25px; font-family: Arial; text-align: center; color: #2068d4; line-height: 1.5;"> <b>π <a href="https://drive.google.com/file/d/1CUNen40OJOCqIr2nM0pjG8TT7l6t9SIe/view?usp=sharing" target="_blank"> Download Biology Question Paper PDF - SET 1 </a> </b> </p>
<p style="font-size: 30px; font-family: Arial; text-align: center; color: #0c8a7d; background-color: #a2f5d3; padding: 10px;"> <b> PART A: BOTANY </b></p>
<style>
/* Customize the box style */
.box {
background-color: #ffffff;
border: 1px solid #ffffff;
border-radius: 1px;
padding: 10px;
margin-bottom: 10px;
margin-right: -14px;
margin-left: -14px;
}
/* Customize the question style */
.question {
font-size: 17px;
font-weight: bold;
color: #3d454a;
font-family: Open Sans;
margin-bottom: 10px;
}
/* Customize the answer style */
.answer {
font-size: 18px;
font-weight: normal;
font-family: Roboto;
margin-bottom: 10px;
background-color: #e7ffde;
}
/* Hide the answer by default */
.answer {
display: none;
}
/* Customize the view/hide answer button */
.answer-button {
background-color: #4CAF50;
border: none;
border-radius: 5px;
color: white;
padding: 8px 16px;
text-align: center;
text-decoration: none;
display: inline-block;
font-size: 18px;
margin-bottom: 1px;
cursor: pointer;
}
/* Style the button differently when it changes to "Hide Answer" */
.answer-button.hide-answer {
background-color: #f44336;
}
/* Show the answer when the visible class is added */
.answer.visible {
display: block;
}
.table-text {
display: grid;
grid-template-columns: 50% 50%;
grid-gap: none;
margin-top: 5px;
border-collapse: collapse;
}
.table-text-2 {
display: grid;
grid-template-columns: 33.33% 33.33% 33.33%;
grid-gap: none;
margin-top: 5px;
border-collapse: collapse;
}
.table-text-header,
.table-text-cell {
padding: 5px;
border: 1px solid black;
text-align: left;
}
.table-text-header {
font-weight: bold;
text-align: center;
}
.no-break {
white-space: nowrap;
}
.tab {
text-indent: 40px; /* Adjust the value as per your preference */
}
</style>
<p style="font-size: 18px; font-family: Arial; text-align: left; color: #5c5c5c; background-color: #ebeaec; padding: 10px;"> <b> <i>I. Answer any 3 questions from 1 β 5. Each carries 1 score. (3 x 1 = 3)</i> </b></p>
<div class="box">
<div class="question">1) Choose the correct answer and fill in the blank. <p>...................... is the female gametophyte of angiosperms.<p>(a) Embryo sac <br>(b) Nucellus <br>(c) Integument <br>(d) Pollen grain </div>
<div class="answer"><p>β
(a) Embryo sac </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question">2) Name the type of interaction between an Orchid plant and Mango tree. </div>
<div class="answer"><p>β
Commensalism </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question">3) Net Primary Productivity (NPP) = β¦β¦β¦β¦... </div>
<div class="answer"><p>β
Gross primary productivity β respiration (GPP β R) </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> 4) Which group of enzymes are known as βmolecular scissorsβ? </div>
<div class="answer"> <p>β
Restriction enzymes </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> 5) Plants, bacteria, fungi and animals whose genes have been altered by manipulation are called β¦β¦β¦β¦β¦ </div>
<div class="answer"><p>β
Genetically Modified Organisms (GMO). </div>
<button class="answer-button">View Answer</button>
</div>
<p style="font-size: 18px; font-family: Arial; text-align: left; color: #5c5c5c; background-color: #ebeaec; padding: 10px;"> <b> <i>II. Answer any 9 questions from 6 β 16. Each carries 2 scores. (9 x 2 = 18)</i> </b> </p>
<div class="box">
<div class="question"> 6) The innermost wall layer of Microsporangium is Tapetum. <p> (a) What is its function? <br>(b) Write two features of Tapetal cells. </div>
<div class="answer"> <p>β
<b>Answer</b></p> a) It nourishes the developing pollen grains. <br>b) Cells of the tapetum possess dense cytoplasm and generally have more than one nucleus. </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> 7) Explain the separation of DNA fragments using gel electrophoresis. </div>
<div class="answer"> <p>β
<b>Answer</b></p> The DNA fragments can be separated by a technique known as gel electrophoresis. DNA fragments are negatively charged. So they move towards the anode under an electric field through a medium/matrix such as agarose gel. The DNA fragments separate according to their size through sieving effect of the agarose gel. The smaller sized fragment moves farther. </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> 8) Write notes on: <p> (a) Microinjection (b) Biolistics </div>
<div class="answer"> <p>β
<b>Answer</b></p> Microinjection and Biolistics are two methods to introduce alien DNA into host cells. <br> <b>(a) Microinjection:</b> In this method, recombinant DNA is directly injected into the nucleus of an animal cell. <br> (b) <b>Biolistics (gene gun):</b> In this, cells are bombarded with high velocity micro-particles of gold or tungsten coated with DNA. It is suitable for plants.
</div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> 9) Define: <p>(a) Apomixis (b) Polyembryony </div>
<div class="answer"> <p>β
<b>Answer</b></p> (a) Apomixis is the production of seeds without fertilisation. <br> (b) Occurrence of more than one embryo in a seed is called Polyembryony.
</div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> 10) Field survey by a team of students recorded the following data related to number of organisms in an ecosystem and plotted that into a figure shown below: <div class="separator" style="clear: both;"><a href="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEjfG6h2L6Dlh8FxgH9wxAFWR9PAjXveyzAGhIB0gSwo_AQzkTVE3cox687kDjnNxFqDhbkJLfEauZollEH9-iH7PLul1lp7yd7EGNsPNKov6FRGeE-NCC_EZpnXdxVnER_vMvbeNEQwGqY3g_f2v8bOu865aO9QTPoERAgXOGDTTgW8HhdcaNvtHw4F95E/s493/+2%20Biology%20Model%20QPs%20for%202024%20exam%20SET%201.jpg" style="display: block; padding: 1em 0; text-align: center; "><img alt="" border="0" width="320" data-original-height="436" data-original-width="493" src="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEjfG6h2L6Dlh8FxgH9wxAFWR9PAjXveyzAGhIB0gSwo_AQzkTVE3cox687kDjnNxFqDhbkJLfEauZollEH9-iH7PLul1lp7yd7EGNsPNKov6FRGeE-NCC_EZpnXdxVnER_vMvbeNEQwGqY3g_f2v8bOu865aO9QTPoERAgXOGDTTgW8HhdcaNvtHw4F95E/s320/+2%20Biology%20Model%20QPs%20for%202024%20exam%20SET%201.jpg"/></a></div> Observe the figure and explain the pyramid.</div>
<div class="answer"> <p>β
<b>Answer</b></p> It is an inverted pyramid of number. If a plant takes an ecosystem number of producer is one more than herbivorous insects, birds, etc. It is 2nd trophic level. 3rd trophic level contains more parasites than herbivores. 4th trophic level contains more hyperparasites than 3rd trophic level parasites. </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> 11) Observe the diagram and answer A and B. <div class="separator" style="clear: both;"><a href="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEgE9b8S91MMdrxAFgNuQuI4bytC6ZGWZ4dlsHuvge0cgif9j1ov5VfN7KkT8VrHntgCv0QGLgSKqcTVwqQQvWdyK947x8I8Glio9meDyXxsnuQ4J-w5KGYU7WNIqQVe2fYXIgAWSSw_W_Q3WTBX0nhOoxDSXLeidPIrHqlXEo7oEtZPkQuRnEYutl-M5LE/s657/+2%20Biology%20Model%20QPs%20for%202024%20exam%20SET%201.jpg" style="display: block; padding: 1em 0; text-align: center; "><img alt="" border="0" width="320" data-original-height="437" data-original-width="657" src="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEgE9b8S91MMdrxAFgNuQuI4bytC6ZGWZ4dlsHuvge0cgif9j1ov5VfN7KkT8VrHntgCv0QGLgSKqcTVwqQQvWdyK947x8I8Glio9meDyXxsnuQ4J-w5KGYU7WNIqQVe2fYXIgAWSSw_W_Q3WTBX0nhOoxDSXLeidPIrHqlXEo7oEtZPkQuRnEYutl-M5LE/s320/+2%20Biology%20Model%20QPs%20for%202024%20exam%20SET%201.jpg"/></a></div> </div>
<div class="answer"> <p>β
<b>Answer</b></p> A= Proinsulin B= Insulin. </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> 12) (a) Define transgenic animals. <p> (b) Write any two uses of transgenic animals. </div>
<div class="answer"> <p>β
<b>Answer</b></p> (a) Transgenic animals are the animals whose genome has been altered by introduction of a foreign gene by manipulation. <br> (b) Uses of transgenic animals: <br>β’ To study regulation of genes and their action on normal physiology & development. <br>β’ To study the contribution of genes in the development of a disease and thereby new treatments. <br>β’ Biological products.<br> β’ Vaccine safety testing. <br> β’ Chemical safety testing (toxicity testing).
</div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> 13) Humification and Mineralization occur during decomposition in the soil. Write the difference between these twoprocesses. </div>
<div class="answer"> <p>β
<b>Answer</b></p> <b>Humification: </b>Accumulation of humus (dark amorphous substance) in soil. Humus is resistant to microbial action and so decomposes very slowly. Being colloidal, it serves as a reservoir of nutrients. <br> <b>Mineralization:</b> It is the release of inorganic nutrients due to the degradation of humus by some microbes.
</div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> 14) Given below in the diagram showing the transfer of pollen grains. <div class="separator" style="clear: both;"><a href="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEjskQBWtCDgLnevkwxvaBDpifvb7kCWENvo4H-uc7sQPNa43eaqS_XUI27SxJXT_vK1_XH5CKg3AnTMIUsJwuhJefL-QkVi0j40OpjrSMsgvnlD26H8o3vGHysVmHLfmI93UuK_Y0KeOoeov89XkfZSfcCfh7ox7MXz0e9_IdQHMacS45sa_kCDK6Wv-dI/s509/+2%20Biology%20Model%20QPs%20for%202024%20exam%20SET%201.jpg" style="display: block; padding: 1em 0; text-align: center; "><img alt="" border="0" width="320" data-original-height="315" data-original-width="509" src="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEjskQBWtCDgLnevkwxvaBDpifvb7kCWENvo4H-uc7sQPNa43eaqS_XUI27SxJXT_vK1_XH5CKg3AnTMIUsJwuhJefL-QkVi0j40OpjrSMsgvnlD26H8o3vGHysVmHLfmI93UuK_Y0KeOoeov89XkfZSfcCfh7ox7MXz0e9_IdQHMacS45sa_kCDK6Wv-dI/s320/+2%20Biology%20Model%20QPs%20for%202024%20exam%20SET%201.jpg"/></a></div>(a) Identify P1 & P2 with technical terms. <br>(b) Critically evaluate P1 & P2. </div>
<div class="answer"> <p>β
<b>Answer</b></p> (a) P1= Autogamy (self-pollination) P2= Geitonogamy <br> (b) <b>Autogamy:</b> In flowers with exposed anthers & stigma, complete autogamy is rare. Autogamy in such flowers requires synchrony in pollen release and stigma receptivity. <br> <b>Geitonogamy:</b> It is functionally cross-pollination involving a pollinating agent. But it is genetically similar to autogamy since the pollen grains come from same plant.
</div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> 15: Observe the equation. <div class="separator" style="clear: both;"><a href="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEgf3Z7QQg0F6vKjnIIGXubumre0UsxKc-sHFOAmAYCEjFOhXfoEb2OcXIg6jOWzrSu2ItBBKFmm0t6EeaQJ8LLKfgL5f6oEzNmYe04q48Xaz-T-DmlNuT3BpKf5nslCxdwJexJE8Qy9VwyUUg3GEa763aZ0AlZ9NTLYqk_LgB18AxcOhQGgEhak3ibKg1s/s258/+2%20Biology%20Model%20QPs%20for%202024%20exam%20SET%201.jpg" style="display: block; padding: 1em 0; text-align: center; "><img alt="" border="0" width="175" data-original-height="94" data-original-width="258" src="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEgf3Z7QQg0F6vKjnIIGXubumre0UsxKc-sHFOAmAYCEjFOhXfoEb2OcXIg6jOWzrSu2ItBBKFmm0t6EeaQJ8LLKfgL5f6oEzNmYe04q48Xaz-T-DmlNuT3BpKf5nslCxdwJexJE8Qy9VwyUUg3GEa763aZ0AlZ9NTLYqk_LgB18AxcOhQGgEhak3ibKg1s/s320/+2%20Biology%20Model%20QPs%20for%202024%20exam%20SET%201.jpg"/></a></div>(a) Which type of growth curve does it represents? <br>(b) What do the following notations represent? <br> i. N ii. r iii. K </div>
<div class="answer"> <p>β
<b>Answer</b></p> (a) Logistic Growth Curve. <p>(b) i. N = Population density at time t <br>ii. r = Intrinsic rate of natural increase <br>iii. K = Carrying capacity
</div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> 16: (a) Construct a Grazing Food Chain (GFC) using the following organisms: <p><center>Bird, Grass, Grasshopper </center><p>(b) Write the trophic level of grasshopper. </div>
<div class="answer"> <p>β
<b>Answer</b></p> (a) Grass β Grasshopper β Bird <br>(b) Second trophic level (Primary consumer). </div>
<button class="answer-button">View Answer</button>
</div>
<p style="font-size: 18px; font-family: Arial; text-align: left; color: #5c5c5c; background-color: #ebeaec; padding: 10px;"> <b> <i>III. Answer any 3 questions from 17 β 20. Each carries 3 scores. (3 x 3 = 9)</i> </b> </p>
<div class="box">
<div class="question"> 17) Raman is learning the post fertilization changes of an angiosperm embryo sac with the help of slides. He identifiedthe egg nucleus and polar nuclei with the help of his teacher. <p>(a) Name the other nuclei present in the embryo sac. <br>(b) Help Raman by giving the changes that takes place with egg nucleus and polar nucleus after fertilization. </div>
<div class="answer"> <p>β
<b>Answer</b></p> (a) Two synergids, Three antipodal cells, One central cell. <br> (b) After fertilization, the following changes take place: <br> β’ The egg nucleus fuses with one of the sperm cells to form a diploid zygote. This zygote will further develop into the embryo. <br> β’ The two polar nuclei fuse with the other sperm cell to form a triploid cell. This triploid cell develops into the endosperm, which provides nutrition to the developing embryo. This process is known as double fertilization. It is a unique feature of angiosperms and results in the formation of a seed containing an embryo (from the zygote) and endosperm (from the triploid cell).
</div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> 18) Density of a population fluctuates due to changes in four basic processes. <br><br>(a) Complete the diagram by adding the points A B C and D. <br>(b) Explain A and D. <div class="separator" style="clear: both;"><a href="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEjTMTwsIzodypbTCenRGKZrMVMUN2kYlaYThczIDyIBjczRTRBn8zWP8gAsZwfLEeS6TKAYn310QeEtfTjDifM20AseGequk8lbeXzW7kdNRWe_4wyMXIU12LhJ4XPmkvTQFvgTspnVSbkRSifWUNNoaeoqhIy7jrJ8XJIRwgnAIOHp81OEF3eGLu9jhaQ/s740/+2%20Biology%20Model%20QPs%20for%202024%20exam%20SET%201.jpg" style="display: block; padding: 1em 0; text-align: center; "><img alt="" border="0" width="320" data-original-height="483" data-original-width="740" src="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEjTMTwsIzodypbTCenRGKZrMVMUN2kYlaYThczIDyIBjczRTRBn8zWP8gAsZwfLEeS6TKAYn310QeEtfTjDifM20AseGequk8lbeXzW7kdNRWe_4wyMXIU12LhJ4XPmkvTQFvgTspnVSbkRSifWUNNoaeoqhIy7jrJ8XJIRwgnAIOHp81OEF3eGLu9jhaQ/s320/+2%20Biology%20Model%20QPs%20for%202024%20exam%20SET%201.jpg"/></a></div></div>
<div class="answer"> <p>β
<b>Answer</b></p> (a) A= Immigration (I) <br>B= Natality (B) <br>C = Mortality (D) <br>D= Emigration (E) <p> (b) <b>Natality (B):</b> It is the number of births in a population during a given period. <br> <b>Mortality (D):</b> It is the number of deaths in a population during a given period. <br> <b>Immigration (I):</b> It is the number of individuals of the same species that have come into the habitat from elsewhere during a given time period. <br> <b>Emigration (E):</b> It is the number of individuals of the population who left the habitat and gone elsewhere during a given time period.
</div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> 19) (a) What is meant by gene therapy? <p>(b)Briefly explain the reason for ADA deficiency disorder. <br>(c)Mention a treatment method for ADA deficiency.</div>
<div class="answer"> <p>β
<b>Answer</b></p> (a) Gene therapy is a method to correct a gene defect in a child/embryo. <br> (b) This is caused due to the deletion of a gene of <i>adenosine deaminase</i> (an enzyme for the functioning of immune system). <br> (c) <b>Gene therapy for ADA deficiency:</b> Collect lymphocytes from the patientβs blood and grow in a culture β Introduce a functional ADA cDNA into lymphocytes (using a retroviral vector) β return them to the patient.
</div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> 20) Amplification of gene of interest is done using PCR. <p>(a) Expand PCR. <br>(b) Mention the three steps of this process. <br>(c) What are primers? </div>
<div class="answer"> <p>β
<b>Answer</b></p> (a) Polymerase Chain Reaction. <p>(b) Three steps of PCR: <br><b>Denaturation:</b> Heating of DNA sample to separate into single strands. <br> <b>Annealing:</b> Joining of the two primers at the 3β end of the DNA templates. <br> <b>Extension:</b> A new strand of DNA is synthesized from the primers. <p> (c) Primers are short, single-stranded DNA sequences that are complementary to the target DNA sequence. They provide a starting point for DNA synthesis during PCR.
</div>
<button class="answer-button">View Answer</button>
</div>
<p style="font-size: 30px; font-family: Arial; text-align: center; color: #993d77; background-color: #ffe0f4; padding: 10px;"> <b> PART B: ZOOLOGY </b></p>
<p style="font-size: 18px; font-family: Arial; text-align: left; color: #5c5c5c; background-color: #ebeaec; padding: 10px;"> <b> <i>I. Answer any 3 questions from 1 β 5. Each carries 1 score. (3 x 1 = 3)</i> </b> </p>
<div class="box">
<div class="question"> 1) The theory which states that the units of life were transferred to different planets including earth is .................... </div>
<div class="answer"><p>β
Theory of Panspermia </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> 2) Identify the odd one out. Justify your answer. <p><center>UAA, AUG, UAG, UGA </center></div>
<div class="answer"><p>β
AUG. It is a start codon. Others are stop codons. </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> 3) The regions with very high species richness, high degree of endemism but most threatened is <p>(a) Sacred groves <br>(b) Hotspots <br>(c) National parks <br>(d) Sanctuary </div>
<div class="answer"><p>β
(b) Hotspots </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> 4) Which of the following is cytokine barrier? <p>(a) Neutrophil <br>(b) Lysozymes <br>(c) Mucus <br>(d) Interferons </div>
<div class="answer"> <p>β
(d) Interferons </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> 5) Note the relationship between the first two words and fill up the fourth place. <p>LNG-20: Hormone releasing IUD <br>Multiload 375: β¦β¦β¦β¦β¦β¦.. </div>
<div class="answer"><p>β
Copper releasing IUD </div>
<button class="answer-button">View Answer</button>
</div>
<p style="font-size: 18px; font-family: Arial; text-align: left; color: #5c5c5c; background-color: #ebeaec; padding: 10px;"> <b> <i>II. Answer any 9 questions from 6 β 16. Each carries 2 scores. (9 x 2 = 18)</i> </b> </p>
<div class="box">
<div class="question"> 6) Given below are the steps of experiments conducted by Frederick Griffith. Complete the remaining steps. <p>β’ S-strain β Inject into mice β Mice die <br>β’ R-strain β Inject into mice β Mice live <br>β’ ............................. <br>β’ .............................. </div>
<div class="answer"> <p>β
<b>Answer</b></p> β’ S-strain (heat killed) β Inject into mice β Mice live <br> β’ S-strain (heat killed) + R-strain (live) β Inject into mice β Mice die </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> 7) Correct the false statements given below (consider the words underlined). <p>a. Progesterone level is increased during <u>proliferative phase.</u> <br>b. <u>Menopause</u> is the first menstruation in the life of a woman. </div>
<div class="answer"> <p>β
<b>Answer</b></p> a. Progesterone level is increased during <u>Luteal (Secretory) phase.</u> <br> b. <u>Menarche</u> is the first menstruation in the life of a woman. </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> 8) To find out the unknown genotype of violet flowered pea plant, a researcher done the following cross. Observe the diagram and answer the following questions. <div class="separator" style="clear: both;"><a href="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEjfivbu2XNgNATfGUqUZzz88N3RXM8Dg0PEpf1bzGDnfJI7IJsp2b6aLygJhS11DDPVuF_taNcnvKT5pVkYDxfaqMeWvkpMz5B5XOBOjj2RCdnjrNmEMeA2CgUG2wYPe23JdQi21D1Oaq_MQeGyhL1EynG4wG5boaSZGQILOLbr6quM6mlWRYPGM22ZxAs/s434/+2%20Biology%20Model%20QPs%20for%202024%20exam%20SET%201.jpg" style="display: block; padding: 1em 0; text-align: center; "><img alt="" border="0" width="320" data-original-height="334" data-original-width="434" src="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEjfivbu2XNgNATfGUqUZzz88N3RXM8Dg0PEpf1bzGDnfJI7IJsp2b6aLygJhS11DDPVuF_taNcnvKT5pVkYDxfaqMeWvkpMz5B5XOBOjj2RCdnjrNmEMeA2CgUG2wYPe23JdQi21D1Oaq_MQeGyhL1EynG4wG5boaSZGQILOLbr6quM6mlWRYPGM22ZxAs/s320/+2%20Biology%20Model%20QPs%20for%202024%20exam%20SET%201.jpg"/></a></div>a. What would be the above cross is called? <br>b. Can you determine the unknown genotype of violet flowered parent by drawing Punnett square? </div>
<div class="answer"> <p>β
<b>Answer</b></p> a. Test cross. <br> b. Yes. <div class="separator" style="clear: both;"><a href="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEiUjMVpxv3UEuFBMByVNGVT8xMFZrlrWoITZdD0uRAEFIj5UR6By9Gu4T64mFOfuZxJ2yB0w4jo6wTzLLjtJeuFSR5xYjL5r6aAzi6FXrKtnH8nIJPFTXfcJVZ60vKmcFXGrWsa3qKd182C5feoYjhYZYmCHyOapqVHmabhh-xmcGYyxAWgYSwvCzAbeoc/s1600/+2%20Biology%20Model%20QPs%20for%202024%20exam%20SET%201.jpg" style="display: block; padding: 1em 0; text-align: center; "><img alt="" border="0" data-original-height="282" data-original-width="721" src="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEiUjMVpxv3UEuFBMByVNGVT8xMFZrlrWoITZdD0uRAEFIj5UR6By9Gu4T64mFOfuZxJ2yB0w4jo6wTzLLjtJeuFSR5xYjL5r6aAzi6FXrKtnH8nIJPFTXfcJVZ60vKmcFXGrWsa3qKd182C5feoYjhYZYmCHyOapqVHmabhh-xmcGYyxAWgYSwvCzAbeoc/s1600/+2%20Biology%20Model%20QPs%20for%202024%20exam%20SET%201.jpg"/></a></div> </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> 9) βChromosomal theory of inheritance was proved through several dihybrid crosses using fruit flies (<i>Drosophila melanogaster</i>).β <p>a. Who conducted this experiment? <br>b. Why did he select <i>Drosophila</i> as the experimental material? (Any three reasons). </div>
<div class="answer"> <p>β
<b>Answer</b></p> a. T.H Morgan <br> b. Morgan selected Drosophila as the experimental material because <br> β’ They can be grown on simple synthetic medium. <br> β’ They complete their life cycle in about two weeks. <br> β’ A single mating can produce a large number of progeny flies. <br> β’ Male and female flies are easily distinguishable. <br> β’ It has many types of hereditary variations that can be seen with low power microscopes.
</div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> 10) Diagram shown below is a surgical method used for male sterilization. <div class="separator" style="clear: both;"><a href="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEihR-VvFwS2uo9QVoNhh8yjoWOX5CD_PmQfDzGlLa-eN7VEYmHal_-GavIulRIP6Dd-Naqfm8d1Jp4m4NFyFE6PsyONPRuLh-mNEgElXBm3L8eqr9SKl2-1UpkzSpCF2jqJMBZu4bL5wNat4aaVwbMcm4rE3aF1XO5IzqLmKxdJv3Em1XFfWDCXYweIIB8/s293/+2%20Biology%20Model%20QPs%20for%202024%20exam%20SET%201.jpg" style="display: block; padding: 1em 0; text-align: center; "><img alt="" border="0" height="320" data-original-height="293" data-original-width="264" src="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEihR-VvFwS2uo9QVoNhh8yjoWOX5CD_PmQfDzGlLa-eN7VEYmHal_-GavIulRIP6Dd-Naqfm8d1Jp4m4NFyFE6PsyONPRuLh-mNEgElXBm3L8eqr9SKl2-1UpkzSpCF2jqJMBZu4bL5wNat4aaVwbMcm4rE3aF1XO5IzqLmKxdJv3Em1XFfWDCXYweIIB8/s320/+2%20Biology%20Model%20QPs%20for%202024%20exam%20SET%201.jpg"/></a></div>a. Name the method shown in the diagram. <br>b. What is the surgical method of female sterilization called? <br>c. What are the advantages of condoms over this method? (Any two). </div>
<div class="answer"> <p>β
<b>Answer</b></p> a. Vasectomy. <br> b. Tubectomy. <br> c. Condoms are reversible. Condoms protect the user from STIs and AIDS. </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> 11) βMore and more children in metro cities of India suffer from allergies and asthma.β Justify this statement. </div>
<div class="answer"> <p>β
<b>Answer</b></p> Modern-day life style and protected environment provided early in life result in low immunity and more sensitivity to allergens. So, many children in metro cities suffer from allergies and asthma. </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> 12) Metastasis and lack of Contact inhibition are two properties of cancer cells. What do you understand by these two terms? </div>
<div class="answer"> <p>β
<b>Answer</b></p> βͺοΈ <b>Metastasis:</b> Cells sloughed from tumours reach other sites via blood where they form a new tumour. It is called metastasis. <br> βͺοΈ <b>Contact inhibition:</b> It is a property of normal cells where contact with the other cells inhibits their uncontrolled growth. </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> 13) Government of India legalised MTP in 1971 with some strict conditions to check illegal female foeticides. <p> a. What is MTP? <br> b. Mention any two importance of MTP. </div>
<div class="answer"> <p>β
<b>Answer</b></p> a. Intentional or voluntary termination of pregnancy before full term is called MTP (Medical Termination of Pregnancy). <br><b>b. importance of MTP:</b> <br> β’ To avoid unwanted pregnancies due to casual sex or failure of the contraceptive used during coitus or rapes. <br> β’ It is essential in cases where continuation of pregnancy could be harmful to the mother or foetus or both. </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> 14) Arrange the following in hierarchical manner based on the period of their evolution. <p> <centre> Homo erectus, Ramapithecus, Australopithecus, Homo sapiens, Neanderthal man, Dryopithecus, Homo habilis </centre> </div>
<div class="answer"> <p>β
<b>Answer</b></p> <i>Dryopithecus β Ramapithecus β Australopithecus β Homo habilis β Homo erectus β Neanderthal man β Homo sapiens</i> </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> 15) Observe the diagram shown below. <div class="separator" style="clear: both;"><a href="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEhmO-YURueaHypgdIX2ZzcorkYKt4G9AfWj5_viIyg0gdgRppT9jX-81tGxBjqf5HWw3vCBd841rK1wv3j7BodTzJgn8C67_iK1wVHkj7QQ5iQuJoML8hMR_gARkTINaTrlG4PpiMpH_nakH1GGR-tLxctgFDpKlxhDoffmvGVKzEyesC_YNBOe8zKmVy0/s1600/+2%20Biology%20Model%20QPs%20for%202024%20exam%20SET%201.jpg" style="display: block; padding: 1em 0; text-align: center; "><img alt="" border="0" data-original-height="186" data-original-width="1030" src="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEhmO-YURueaHypgdIX2ZzcorkYKt4G9AfWj5_viIyg0gdgRppT9jX-81tGxBjqf5HWw3vCBd841rK1wv3j7BodTzJgn8C67_iK1wVHkj7QQ5iQuJoML8hMR_gARkTINaTrlG4PpiMpH_nakH1GGR-tLxctgFDpKlxhDoffmvGVKzEyesC_YNBOe8zKmVy0/s1600/+2%20Biology%20Model%20QPs%20for%202024%20exam%20SET%201.jpg"/></a></div>a. Identify the diagram. <br> b. Label A, B & C. </div>
<div class="answer"> <p>β
<b>Answer</b></p> a. Transcription Unit. <br> b. A= Promoter, B= Terminator, C= Coding strand. </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> 16) Fill the columns A & B using the words given below. <div class="separator" style="clear: both;"><a href="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEiqlPhDtr0NP1k7ugeKGoARc4oQd4zww02yHoDdX_s2p-hGnE53MOvuiOsGBv6gRdKa_0Q9NQjHCcKz6S-_nMyRAMp1KBfR5b7Q3bFr1AkXuRl53epXktMU9v2UwLaeS2725bF6wWPI3VA8P5SVOIKhPH1YytxiPqefGv-YoTiNpM_fl4i5dXhWIXENMr0/s1600/bob.jpg" style="display: block; padding: 1em 0; text-align: center; "><img alt="" border="0" data-original-height="177" data-original-width="825" src="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEiqlPhDtr0NP1k7ugeKGoARc4oQd4zww02yHoDdX_s2p-hGnE53MOvuiOsGBv6gRdKa_0Q9NQjHCcKz6S-_nMyRAMp1KBfR5b7Q3bFr1AkXuRl53epXktMU9v2UwLaeS2725bF6wWPI3VA8P5SVOIKhPH1YytxiPqefGv-YoTiNpM_fl4i5dXhWIXENMr0/s1600/bob.jpg"/></a></div> <center> (Lamarckism, Development of DDT resistant ants, Gene flow by chance, Adaptive radiation, de Vries)</center> </div>
<div class="answer"> <p>β
<b>Answer</b></p> <div class="separator" style="clear: both;"><a href="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEjTvfSCh-_soFkW1_4Lc0ajzRJIxLQX0e5kMoSDfAL7zCsXLHI2osGH3dfR6xIByq-G5L4yh1xikpJ3Mu-g8-0YT14zV5nQou0Qt29Zb6urFaPK6HEqUebkdKhcn85CrBwIehJn8TgqIcvNe9kZ8uyVbrNRM4pQBJ5wGxVscM8cPNW2ceoXDtHes-TdVrw/s1600/bob.jpg" style="display: block; padding: 1em 0; text-align: center; "><img alt="" border="0" data-original-height="193" data-original-width="822" src="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEjTvfSCh-_soFkW1_4Lc0ajzRJIxLQX0e5kMoSDfAL7zCsXLHI2osGH3dfR6xIByq-G5L4yh1xikpJ3Mu-g8-0YT14zV5nQou0Qt29Zb6urFaPK6HEqUebkdKhcn85CrBwIehJn8TgqIcvNe9kZ8uyVbrNRM4pQBJ5wGxVscM8cPNW2ceoXDtHes-TdVrw/s1600/bob.jpg"/></a></div> </div>
<button class="answer-button">View Answer</button>
</div>
<p style="font-size: 18px; font-family: Arial; text-align: left; color: #5c5c5c; background-color: #ebeaec; padding: 10px;"> <b> <i>III. Answer any 3 questions from 17 β 20. Each carries 3 scores. (3 x 3 = 9)</i> </b> </p>
<div class="box">
<div class="question"> 17) Steps of DNA fingerprinting are shown below. <br>a. Complete the flow chart given below and answer the following questions. <div class="separator" style="clear: both;"><a href="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEjWV8oNNHpFj6192byoqamYN-8MwtasVZ0u_TrKhGUpoaqqXv6hWWo6OCnTTx46W47kXxqeVjfmUNeGkOuG6On2chNe0-k5320Js7BO11pc3KT0Td7BaQz9idlu7PmwYDAB6bC-8yAKOzfjapG4ciMWIxRzejgwEgNKKgmDq0SYfESqHr-OPOXS2b6Y0ok/s1600/+2%20Biology%20Model%20QPs%20for%202024%20exam%20SET%201.jpg" style="display: block; padding: 1em 0; text-align: center; "><img alt="" border="0" data-original-height="127" data-original-width="887" src="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEjWV8oNNHpFj6192byoqamYN-8MwtasVZ0u_TrKhGUpoaqqXv6hWWo6OCnTTx46W47kXxqeVjfmUNeGkOuG6On2chNe0-k5320Js7BO11pc3KT0Td7BaQz9idlu7PmwYDAB6bC-8yAKOzfjapG4ciMWIxRzejgwEgNKKgmDq0SYfESqHr-OPOXS2b6Y0ok/s1600/+2%20Biology%20Model%20QPs%20for%202024%20exam%20SET%201.jpg"/></a></div> b. Mention the principles behind the DNA fingerprinting. <br>c. DNA fingerprinting is a gift to forensic science. Do you agree? Give reason. </div>
<div class="answer"> <p>β
<b>Answer</b></p> a. (i) Digestion of DNA by restriction endonucleases. <br> (ii) Hybridization using radioactive labelled VNTR probe. <br> b. DNA carries some non-coding repetitive sequences. A DNA sequence which is tandemly repeated in many copy numbers is called variable number tandem repeats (VNTR). VNTR is specific from person to person. <br> c. Yes. Because DNA fingerprinting is a forensic tool to solve paternity, rape, murder etc.
</div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> 18) βPlacenta is a structural and functional unit between foetus and maternal bodyβ. <p> a. Name the foetal and maternal parts that are interdigitated to form placenta. <br> b. Why it is considered as structural and functional unit? (Any 2 reasons). <br> c. Placenta also acts as an endocrine gland. Do you agree? Justify. </div>
<div class="answer"> <p>β
<b>Answer</b></p> a. Foetal part is chorionic villi. Maternal part is Uterine tissue (endometrium). <br> b. It supplies O2, nutrients etc. from mother to foetus. Removes CO2 and excretory wastes from foetus. <br> c. Yes. Placenta secretes Human chorionic gonadotropin (hCG), human placental lactogen (hPL), oestrogens, progesterone & Relaxin. </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> 19) Match the column A with column B. <div class="separator" style="clear: both;"><a href="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEia878Ov1iW6jt-_8mjteUBrgiXcx8GaW2XiML1BJIGNXDzGSoTJsOj458-OsrB9Y0zgoccfCcRTmmDv3HDbAL2CtAAO8wnH-CGqk1qkwDzwBMKfNF6XDeTm2nQXpiSGI1tUyEaEV4NAERjsFRSd2uKDFjYeARo1aHDSPnovvmFOCvtOvwlVARGEh4MOcY/s1600/bob.jpg" style="display: block; padding: 1em 0; text-align: center; "><img alt="" border="0" data-original-height="289" data-original-width="778" src="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEia878Ov1iW6jt-_8mjteUBrgiXcx8GaW2XiML1BJIGNXDzGSoTJsOj458-OsrB9Y0zgoccfCcRTmmDv3HDbAL2CtAAO8wnH-CGqk1qkwDzwBMKfNF6XDeTm2nQXpiSGI1tUyEaEV4NAERjsFRSd2uKDFjYeARo1aHDSPnovvmFOCvtOvwlVARGEh4MOcY/s1600/bob.jpg"/></a></div></div>
<div class="answer"> <p>β
<b>Answer</b></p> <div class="separator" style="clear: both;"><a href="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEg8dLXEW3zaFjO4WgYuEoNY6N7FND9zctuRSX-Qr1mRuAHu_R-L7b0JCYT8rhkl8xrk7TBmcjwPo3a3It6Y8t_aTN6Xd8agyb0x0jObMxwSTT8higo947qnZ2b3SeaZny7TEJgTsF5D7Ndg34T4HV76xDYBEwme4SBLMPTnD23s8bL-k_CK_hGGUcU5OU0/s1600/bob.jpg" style="display: block; padding: 1em 0; text-align: center; "><img alt="" border="0" data-original-height="258" data-original-width="775" src="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEg8dLXEW3zaFjO4WgYuEoNY6N7FND9zctuRSX-Qr1mRuAHu_R-L7b0JCYT8rhkl8xrk7TBmcjwPo3a3It6Y8t_aTN6Xd8agyb0x0jObMxwSTT8higo947qnZ2b3SeaZny7TEJgTsF5D7Ndg34T4HV76xDYBEwme4SBLMPTnD23s8bL-k_CK_hGGUcU5OU0/s1600/bob.jpg"/></a></div> </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> 20) Gopalan cultivated a variety of fruit crops and plants in his field and Raman destroyed the fruit crops and plantsand cultivated rubber trees which are double in number. <p>a. In your opinion, which method is suitable for the ecosystem? Give reason. <br>b. Mention any three factors that lead to the extinction of species. </div>
<div class="answer"> <p>β
<b>Answer</b></p> a. The method of Gopalan is more suitable for the ecosystem. Diverse cultivation provides habitats for various species, promoting soil health and ecological balance. <br> b. (i) Habitat loss and fragmentation. <br> (ii) Overexploitation <br> (iii) Alien species invasion. <br> (iv) Coextinction.
</div>
<button class="answer-button">View Answer</button>
</div>
<script>
// Get all the answer buttons
const answerButtons = document.querySelectorAll('.answer-button');
// Add a click event listener to each answer button
answerButtons.forEach(button => {
button.addEventListener('click', () => {
// Get the answer section for this button
const answerSection = button.previousElementSibling;
// Toggle the answer section's visibility
answerSection.classList.toggle('visible');
// Change the button text to "Hide Answer" or "View Answer"
if (answerSection.classList.contains('visible')) {
button.textContent = 'Hide Answer';
button.classList.add('hide-answer');
} else {
button.textContent = 'View Answer';
button.classList.remove('hide-answer');
}
});
});
</script>
<html>
<head>
<style>
.special-paragraph {
margin-bottom: -10px; /* Adjust this value to reduce the space */
color: #333333;
font-family: Arial, sans-serif;
font-size: 23px;
font-weight: bold;
line-height: 1.5;
padding: 7px;
text-align: center;
border-radius: 10px;
}
.green-bg {
background-color: #ddffd9; /* Green background */
}
.blue-bg {
background-color: #b0eaff; /* Blue background */
}
</style>
</head>
<body>
<p class="special-paragraph green-bg">
<a href="https://www.bankofbiology.com/2020/10/hse-1-2-model-qp-online-exam-series.html" style="color: green;"> π Other Question Papers </a>
</p>
<p class="special-paragraph blue-bg">
<a href="https://www.bankofbiology.com/p/question-bank.html" style="color: blue;"> π Exam Special Materials </a>
</p>
</body>
</html>
<div class="blogger-post-footer"><p> Β© copyright 2024 β All rights reserved </p>
<a href=βhttps://www.bankofbiology.comβ>bankofbiology.com</a></div>Abu Raniyahttp://www.blogger.com/profile/14189496606355139812noreply@blogger.com0tag:blogger.com,1999:blog-6823671394482492613.post-17766883238686194262024-02-27T13:22:00.001+05:302024-03-13T17:10:39.393+05:30Chapter-wise Q & A | Plus 1 Zoology<div dir="ltr" style="text-align: left;" trbidi="on">
<h1 style="background-color: white; font-family: Arial, Tahoma, Helvetica, FreeSans, sans-serif; margin: 0px; position: relative; text-align: center;"><b><span style="color: #cc0000; font-size: x-large;">Plus 1 Zoology Sample Q & A</span></b></h1>
<h3 style="text-align: left;"><span style="font-size: medium;"><b style="background-color: white; color: #222222; font-family: Arial, Tahoma, Helvetica, FreeSans, sans-serif;"><a href="https://www.bankofbiology.com/2023/06/the-living-world-class-11-sample-qa.html" target="_blank">1. The Living World</a><br /></b><b style="background-color: white; color: #222222; font-family: Arial, Tahoma, Helvetica, FreeSans, sans-serif;"><a href="https://drive.google.com/file/d/18VAeG08q4W_f-L_VCUc3eRh7r3r3PU3K/view?usp=drive_link" target="_blank">2. Animal Kingdom</a><br /></b><b style="background-color: white; color: #222222; font-family: Arial, Tahoma, Helvetica, FreeSans, sans-serif;"><a href="https://drive.google.com/file/d/18j7KWCb2hip-y3FxtTmUVokVxNkSvNMk/view?usp=drive_link" target="_blank">3. Structural Organisation in animals</a><br /></b><b style="background-color: white; color: #222222; font-family: Arial, Tahoma, Helvetica, FreeSans, sans-serif;"><a href="https://drive.google.com/file/d/18e6aFyHRZMxf9USukuTHfVL24UPpbbDv/view?usp=drive_link" target="_blank">4. Biomolecules</a> <br /></b><b style="background-color: white; color: #222222; font-family: Arial, Tahoma, Helvetica, FreeSans, sans-serif;">5. Digestion and Absorption <br /></b><b style="background-color: white; color: #222222; font-family: Arial, Tahoma, Helvetica, FreeSans, sans-serif;"><a href="https://drive.google.com/file/d/18X8FAtRrOOOiOAdIpG5idfRdqTP23x24/view?usp=drive_link" target="_blank">6. Breathing and Exchange of gases</a> <br /></b><b style="background-color: white; color: #222222; font-family: Arial, Tahoma, Helvetica, FreeSans, sans-serif;"><a href="https://drive.google.com/file/d/18rxoxCZoLuTSXiGuRZPx8GX17_tUeMvL/view?usp=drive_link" target="_blank">7. Body fluids and Circulation</a> <br /></b><b style="background-color: white; color: #222222; font-family: Arial, Tahoma, Helvetica, FreeSans, sans-serif;"><a href="https://drive.google.com/file/d/18w0QPU6EMQ08Aa1Tccr_2m1SoaeJBZht/view?usp=drive_link" target="_blank">8. Excretory Products & their Elimination</a><br /></b><b style="background-color: white; color: #222222; font-family: Arial, Tahoma, Helvetica, FreeSans, sans-serif;"><a href="https://drive.google.com/file/d/18yx69p9A9DD3ULcBrEkjSQfeYkzewX2U/view?usp=drive_link" target="_blank">9. Locomotion and Movement</a> <br /></b><b style="background-color: white; color: #222222; font-family: Arial, Tahoma, Helvetica, FreeSans, sans-serif;"><a href="https://drive.google.com/file/d/19cK8Qqb1e-AbDXzA4SNRGilTrHUBvmQq/view?usp=drive_link" target="_blank">10. Neural control & Co-ordination</a><br /></b><b style="background-color: white; color: #222222; font-family: Arial, Tahoma, Helvetica, FreeSans, sans-serif;"><a href="https://drive.google.com/file/d/19oudiXQU4yf2CJULOTekn_FgJJa-bsey/view?usp=drive_link" target="_blank">11. Chemical co-ordination & Integration</a></b></span></h3><ol style="background-color: white; color: #222222; font-family: Arial, Tahoma, Helvetica, FreeSans, sans-serif; font-size: 15.4px; text-align: left;">
</ol><div><span face="Arial, Tahoma, Helvetica, FreeSans, sans-serif" style="color: #222222;"><span style="font-size: 15.4px;"><b><br /></b></span></span></div><div><h1><span style="font-family: Oswald; font-weight: normal;"><span style="font-size: large;"><span style="color: #38761d;"><span> π </span><a href="http://www.bankofbiology.com/2012/12/plus-two-zoology-previous-years.html" target="_blank">+2 PREVIOUS YEARS QUESTION PAPERS & ANSWERS</a></span></span><span style="font-size: large;"><span style="color: #38761d;"><span><br /></span></span></span></span></h1><h1><span style="font-family: Oswald; font-weight: normal;"><span style="font-size: large;"><span style="color: #38761d;"><span> π <a href="https://www.bankofbiology.com/2020/10/plus-one-class-11-biology-previous.html" target="_blank">+1 </a></span><a href="https://www.bankofbiology.com/2020/10/plus-one-class-11-biology-previous.html" target="_blank">PREVIOUS YEARS QUESTION PAPERS & ANSWERS</a></span></span><span style="font-size: large;"><span style="color: #38761d;"><span><br /></span></span></span></span></h1><h1><span style="font-family: Oswald; font-weight: normal;"><span style="font-size: large;"><span style="color: #38761d;"><span> π </span><a href="https://www.bankofbiology.com/2019/01/chapter-wise-previous-year-questions.html" target="_blank">CHAPTER-WISE Q & A, ONLINE UNIT TESTS</a><span> </span></span></span><span style="font-size: large;"><span><span style="color: #38761d;"><span><br /></span></span></span></span></span></h1><div><span style="font-size: large;"><span style="color: #38761d;"><span><h1 style="color: black;"><span style="font-size: large;"><span style="color: #38761d; font-family: Oswald;"><span> π </span><span style="font-weight: normal;"><a href="https://www.bankofbiology.com/2020/10/hse-1-2-model-qp-online-exam-series.html" target="_blank">HSE (+1, +2) MODEL QP & ONLINE EXAM SERIES</a><span> </span></span></span></span></h1></span></span></span></div><h1><span style="font-size: large;"><span><span style="color: #38761d; font-family: Oswald; font-weight: normal;"><span> π </span><a href="http://www.bankofbiology.com/2018/02/ncert-questions-with-answers-class-xii.html" target="_blank">NCERT QUESTIONS WITH ANSWERS CLASS XII/ PLUS TWO</a></span></span></span></h1><h1><span style="font-family: Oswald; font-size: large;"><span style="font-weight: normal;"><span style="color: #38761d;"> π </span><a href="http://www.bankofbiology.com/2018/02/ncert-questions-with-answers-class-xi.html" target="_blank">NCERT QUESTIONS WITH ANSWERS CLASS XI/ PLUS ONE</a></span><span style="color: #38761d;"> </span></span></h1></div>
</div>
<div class="blogger-post-footer"><p> Β© copyright 2024 β All rights reserved </p>
<a href=βhttps://www.bankofbiology.comβ>bankofbiology.com</a></div>Abu Raniyahttp://www.blogger.com/profile/14189496606355139812noreply@blogger.com0tag:blogger.com,1999:blog-6823671394482492613.post-74718691236652936522024-01-15T19:16:00.000+05:302024-01-16T20:12:08.278+05:30Plus 2 Zoology Practical Exam Tips (2024) PPT PDF slides and 5-page capsule notes
<html lang="en">
<head>
<meta charset="UTF-8"></meta>
<meta content="width=device-width, initial-scale=1.0" name="viewport"></meta>
<title>Presentation</title>
<style>
body {
font-family: Arial, sans-serif;
background-color: #f2f2f2;
}
.presentation {
font-size: 20px;
margin: 0 auto;
}
.download {
font-size: 25px;
margin: 0 auto;
text-align: center;
}
</style>
</head>
<body>
<div class="presentation">
<p><b> Exam capsule PDF slide and capsule notes are strictly designed for Plus 2 Zoology Practical Examination 2024 </b></p>
</div>
<div class="download">
<p><b>π <a href="https://drive.google.com/file/d/11Fffl2lkWDczXOyRk1ZvVbfWACzrzTBk/view?usp=sharing" target="_blank">Download PDF Slides </a></b></p>
<p><b>π <a href="https://drive.google.com/file/d/1QDQgzBloCSbrq5HdTDwLJ7jG5F1Q7gHY/view?usp=sharing" target="_blank">Download PDF 5-page capsule </a></b></p>
</div>
</body>
</html>
<iframe allow="autoplay" height="480" src="https://drive.google.com/file/d/11Fffl2lkWDczXOyRk1ZvVbfWACzrzTBk/preview" width="100%"></iframe>
<div class="blogger-post-footer"><p> Β© copyright 2024 β All rights reserved </p>
<a href=βhttps://www.bankofbiology.comβ>bankofbiology.com</a></div>Abu Raniyahttp://www.blogger.com/profile/14189496606355139812noreply@blogger.com0tag:blogger.com,1999:blog-6823671394482492613.post-86486703099277954902023-12-29T21:41:00.009+05:302023-12-29T21:50:31.973+05:30Evolution | Class 12 | One-Word Answer type Questions | Topic - wise<!DOCTYPE html>
<html>
<head>
<title>Example Webpage</title>
<style>
body {
user-select: none; /* Prevent selection of text */
-moz-user-select: none; /* Firefox */
-webkit-user-select: none; /* Safari and Chrome */
-ms-user-select: none; /* Internet Explorer/Edge */
}
h1 {
user-select: text; /* Allow selection of title */
}
</style>
</head>
<p style="font-size: 22px; font-family: Arial; text-align: center; color: #0c8a7d;"> <b> Topic 1: ORIGIN OF LIFE </b> </p>
<style>
/* Customize the box style */
.box {
background-color: #f2feff;
border: 1px solid #217f71;
border-radius: 5px;
padding: 10px;
margin-bottom: 10px;
margin-right: -7px;
margin-left: -7px;
}
/* Customize the question style */
.question {
font-size: 17px;
font-weight: bold;
color: #3d454a;
font-family: Roboto;
margin-bottom: 10px;
}
/* Customize the answer style */
.answer {
font-size: 18px;
font-weight: normal;
font-family: Roboto;
margin-bottom: 10px;
}
/* Hide the answer by default */
.answer {
display: none;
}
/* Customize the view/hide answer button */
.answer-button {
background-color: #4CAF50;
border: none;
border-radius: 5px;
color: white;
padding: 8px 16px;
text-align: center;
text-decoration: none;
display: inline-block;
font-size: 18px;
margin-bottom: 1px;
cursor: pointer;
}
/* Style the button differently when it changes to "Hide Answer" */
.answer-button.hide-answer {
background-color: #f44336;
}
/* Show the answer when the visible class is added */
.answer.visible {
display: block;
}
.table-text {
display: grid;
grid-template-columns: 50% 50%;
grid-gap: none;
margin-top: 5px;
border-collapse: collapse;
}
.table-text-2 {
display: grid;
grid-template-columns: 33.33% 33.33% 33.33%;
grid-gap: none;
margin-top: 5px;
border-collapse: collapse;
}
.table-text-header,
.table-text-cell {
padding: 5px;
border: 1px solid black;
text-align: left;
}
.table-text-header {
font-weight: bold;
text-align: center;
}
.no-break {
white-space: nowrap;
}
.tab {
text-indent: 40px; /* Adjust the value as per your preference */
}
</style>
<div class="box">
<div class="question">Q 1: Name the theory which states that universe originated about 13.8 billion years ago by a singular huge explosion. </div>
<div class="answer"><p>β
Big Bang Theory </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question">Q 2: The earth was formed about β¦β¦β¦. ago. </div>
<div class="answer"><p>β
4.5 billion years </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question">Q 3: Which of the following was not present in the atmosphere of primitive earth? <br> Water vapour, Oxygen, CH<sub>4</sub>, CO<sub>2</sub>, NH<sub>3</sub> </div>
<div class="answer"><p>β
Oxygen </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> Q 4: In primitive earth, the ........ from the sun broke up water into H<sub>2</sub> and O<sub>2</sub>. </div>
<div class="answer"> <p>β
UV rays </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question">Q 5: Life appeared on earth almost β¦β¦. ago. </div>
<div class="answer"><p>β
Four billion years </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> Q 6: β¦β¦β¦. states that life came out of decaying and rotting matter like straw, mud etc. </div>
<div class="answer"> <p>β
Theory of spontaneous generation </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question">Q 7: Theory of spontaneous generation was experimentally disproved by </div>
<div class="answer"><p>β
Louis Pasteur </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> Q 8: β¦β¦β¦β¦β¦.. states that life originates from pre-existing life. </div>
<div class="answer"> <p>β
Biogenesis </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question">Q 9: Which theory states that the units of life (spores) were transferred to different planets including earth? </div>
<div class="answer"><p>β
Theory of Panspermia </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> Q 10: Which theory states that living things were created by some supernatural power? </div>
<div class="answer"> <p>β
Theory of special creation </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question">Q 11: Theory of chemical evolution was proposed by </div>
<div class="answer"><p>β
Oparin & Haldane </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> Q 12: The first form of life was originated from non-living inorganic & organic molecules such as CH<sub>4</sub>, NH<sub>3</sub>, H<sub>2</sub>O, sugars, proteins, nucleic acids etc. This theory is known as </div>
<div class="answer"> <p>β
Theory of chemical evolution </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question">Q 13: β¦β¦β¦β¦. experimentally proved theory of chemical evolution. </div>
<div class="answer"><p>β
S.L Miller </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> Q 14: S.L Miller created a condition like that of primitive earth using the gases such as β¦β¦β¦β¦ </div>
<div class="answer"> <p>β
CH<sub>4</sub>, NH<sub>3</sub>, H<sub>2</sub>O, H<sub>2</sub> </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question">Q 15: S.L Miller, in his experiment, found that some β¦β¦β¦. were formed in closed flask. </div>
<div class="answer"><p>β
Amino acids </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> Q 16: First non-cellular forms of life originated β¦β¦β¦. ago. </div>
<div class="answer"> <p>β
3 billion years </div>
<button class="answer-button">View Answer</button>
</div>
<p style="font-size: 22px; font-family: Arial; text-align: center; color: #0c8a7d;"> <b> Topic 2: EVIDENCES FOR EVOLUTION </b> </p>
<div class="box">
<div class="question">Q 17: β¦β¦β¦. are remains of hard parts of life-forms found in rocks. </div>
<div class="answer"><p>β
Fossils </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> Q 18: Cross-section of earth's crust shows β¦β¦β¦. where fossils of different ages are found. </div>
<div class="answer"> <p>β
Sedimentary rock layers </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question">Q 19: The organs having fundamentally similar structure and origin but different functions are called </div>
<div class="answer"><p>β
Homologous organs </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> Q 20: Human hand, Whaleβs flippers, Batβs wing & Cheetahβs foot are examples for </div>
<div class="answer"> <p>β
Homologous organs </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question">Q 21: β¦β¦β¦β¦. is also exhibited in plant parts such as thorns of <i>Bougainvillea</i> and tendrils of <i>Cucurbita</i>. </div>
<div class="answer"><p>β
Homology </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> Q 22: The origin of homologous organs is due to </div>
<div class="answer"> <p>β
Divergent evolution </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question">Q 23: In organisms, same structure develops along different directions due to adaptations to different needs. This is called </div>
<div class="answer"><p>β
Divergent evolution </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> Q 24: β¦β¦β¦.. indicates common ancestry. </div>
<div class="answer"> <p>β
Homology </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question">Q 25: The organs having similar function but different structure & origin are called </div>
<div class="answer"><p>β
Analogous organs </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> Q 26: Wings of butterfly and wings of birds are example for </div>
<div class="answer"> <p>β
Analogous organs </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question">Q 27: Which of the following is not an example for Analogy? <p> (a) Eyes of Octopus and mammals <br> (b) Batβs wing and Cheetahβs foot <br> (c) Flippers of Penguins and Dolphins <br> (d) Sweet potato and Potato </div>
<div class="answer"><p>β
(b) Batβs wing and Cheetahβs foot </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> Q 28: The evolution by which different structures evolve for the same function and become similar is called </div>
<div class="answer"> <p>β
Convergent evolution </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question">Q 29: The origin of analogous organs is due to </div>
<div class="answer"><p>β
Convergent evolution </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> Q 30: β¦β¦β¦β¦ rejected the Embryological evidences for evolution proposed by Ernst Haeckel. </div>
<div class="answer"> <p>β
Karl Ernst von Baer </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> Q 31: The process in which organisms with better favourable & heritable variation are survived and reproduced is called </div>
<div class="answer"> <p>β
Natural selection </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> Q 32: In England, after industrialization (1920), there were <p> (a) More dark-winged moths & less white winged moths. <br> (b) More white winged moths & less dark-winged moths. <br> (c) Equal number of dark-winged moths & less white winged moths. <br> (d) Dark-winged & white winged moths disappeared </div>
<div class="answer"> <p>β
(a) More dark-winged moths & less white winged moths </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> Q 33: Development of resistant varieties in organisms against herbicides, pesticides, antibiotics or drugs etc. are examples for natural selection by ............ </div>
<div class="answer"> <p>β
Anthropogenic action </div>
<button class="answer-button">View Answer</button>
</div>
<p style="font-size: 22px; font-family: Arial; text-align: center; color: #0c8a7d;"> <b> Topic 3: WHAT IS ADAPTIVE RADIATION? </b> </p>
<div class="box">
<div class="question"> Q 34: The evolution of different species from an ancestor in a geographical area starting from a point and radiating to other areas of geography (habitats) is called </div>
<div class="answer"> <p>β
Adaptive radiation </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> Q 35: Darwinβs finches in Galapagos Islands, Australian Marsupial radiation, Placental mammals in Australia etc. are examples for </div>
<div class="answer"> <p>β
Adaptive radiation </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> Q 36: When more than one adaptive radiation is appeared in an isolated geographical area, it results in ........... </div>
<div class="answer"> <p>β
Convergent evolution </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> Q 37: Australian Marsupials such as Flying phalanger and Placental mammals such as Flying squirrel show similarity. This is due to </div>
<div class="answer"> <p>β
Convergent evolution </div>
<button class="answer-button">View Answer</button>
</div>
<p style="font-size: 22px; font-family: Arial; text-align: center; color: #0c8a7d;"> <b> Topic 4: BIOLOGICAL EVOLUTION - THEORIES </b> </p>
<div class="box">
<div class="question"> Q 38: Theory of Inheritance of Acquired characters was proposed by </div>
<div class="answer"> <p>β
Lamarck </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> Q 39: According to Lamarck, Acquired characters are developed by β¦β¦β¦.. of organs. </div>
<div class="answer"> <p>β
Use and disuse </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> Q 40: Long neck of giraffe is due to continuous elongation to forage leaves on trees and disappearance of limbs in snakes are the examples for evolution proposed by ....... </div>
<div class="answer"> <p>β
Lamarck </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> Q 41: Theory of Natural selection was proposed by </div>
<div class="answer"> <p>β
Charles Darwin </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> Q 42: Theory of Natural selection was based on observations during a sea voyage in a sail ship called </div>
<div class="answer"> <p>β
H.M.S. Beagle </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> Q 43: β¦β¦β¦β¦. a naturalist worked in Malay Archipelago had come to similar conclusions of Natural selection proposed by Darwin. </div>
<div class="answer"> <p>β
Alfred Wallace </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> Q 44: Work of β¦β¦β¦β¦β¦ on populations influenced Darwin. </div>
<div class="answer"> <p>β
Thomas Malthus </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> Q 45: β¦β¦β¦β¦β¦. and natural selection are the two key concepts of Darwinian Theory of Evolution. </div>
<div class="answer"> <p>β
Branching descent </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> Q 46: Heritable variations, Overproduction, Limited natural resources, Struggle for existence and Survival of the fittest are some observations in the theory of </div>
<div class="answer"> <p>β
Natural selection </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> Q 47: Mutation Theory of evolution was proposed by </div>
<div class="answer"> <p>β
Hugo de Vries </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> Q 48: de Vries conducted experiments on the plant .......... </div>
<div class="answer"> <p>β
Evening primrose </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> Q 49: β¦β¦β¦β¦ is minor, slow, directional and results in gradual evolution. </div>
<div class="answer"> <p>β
Darwinian variation </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> Q 50: β¦β¦β¦ is sudden, random, directionless and speciation occurs by saltation. </div>
<div class="answer"> <p>β
Mutational variation </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> Q 51: β¦β¦β¦β¦ is the origin of variation for evolution. </div>
<div class="answer"> <p>β
Mutation </div>
<button class="answer-button">View Answer</button>
</div>
<p style="font-size: 22px; font-family: Arial; text-align: center; color: #0c8a7d;"> <b> Topic 5: HARDY-WEINBERG PRINCIPLE </b> </p>
<div class="box">
<div class="question"> Q 52: The allele frequencies in a population are stable and is constant from generation to generation in the absence of disturbing factors. This is called </div>
<div class="answer"> <p>β
Hardy-Weinberg principle </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> Q 53: Sum total of all the allelic frequencies would be ...... </div>
<div class="answer"> <p>β
1 </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> Q 54: In a diploid, p & q are the frequencies of alleles A & a respectively. Then total frequency would be β¦β¦β¦β¦. <p> (a) p + q = 1 <br> (b) p<sup>2</sup> + q<sup>2</sup> = 1 <br> (c) p<sup>2</sup> + 2pq + q<sup>2</sup> = 1 <br> (d) p + 2pq + q = 1 </div>
<div class="answer"> <p>β
(c) p<sup>2</sup> + 2pq + q<sup>2</sup> = 1 </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> Q 55: Change of frequency of alleles in a population disturbs ......... </div>
<div class="answer"> <p>β
Hardy-Weinberg equilibrium </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> Q 56: Gene migration, genetic drift, mutation, genetic recombination and natural selection are the factors affecting β¦β¦β¦β¦β¦ </div>
<div class="answer"> <p>β
Hardy-Weinberg equilibrium </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> Q 57: The gene flow from one population to another that results change in gene frequencies in both populations is called </div>
<div class="answer"> <p>β
Gene migration </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> Q 58: The gene flow by chance causing change in frequency is called </div>
<div class="answer"> <p>β
Genetic drift </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> Q 59: Due to genetic drift, the frequency change can lead to evolve into a different species and the original drifted population becomes founders. It is called .......... </div>
<div class="answer"> <p>β
Founder effect </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> Q 60: The natural selection where more individuals acquire mean character value and variation is reduced is called </div>
<div class="answer"> <p>β
Stabilizing selection </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> Q 61: The natural selection where individuals of one extreme (value other than mean character value) are more favoured is called </div>
<div class="answer"> <p>β
Directional selection </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> Q 62: The natural selection where individuals of both extremes (peripheral character value at both ends of the distribution curve) are more favoured is called </div>
<div class="answer"> <p>β
Disruptive selection </div>
<button class="answer-button">View Answer</button>
</div>
<p style="font-size: 22px; font-family: Arial; text-align: center; color: #0c8a7d;"> <b> Topic 6: A BRIEF ACCOUNT OF EVOLUTION </b> </p>
<div class="box">
<div class="question"> Q 63: First cellular forms of life appeared β¦β¦β¦β¦β¦. million yrs ago. </div>
<div class="answer"> <p>β
2000 mya </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> Q 64: By the time of β¦β¦β¦β¦.., invertebrates were formed and active. </div>
<div class="answer"> <p>β
500 mya </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> Q 65: Jawless fishes were evolved around ........ </div>
<div class="answer"> <p>β
350 mya </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> Q 66: Sea weeds and few plants existed probably around ........ </div>
<div class="answer"> <p>β
320 mya </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> Q 67: Fish with stout and strong fins could move on land and go back to water about ........ </div>
<div class="answer"> <p>β
350 mya </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> Q 68: The animals called β¦β¦β¦. evolved into first amphibians. </div>
<div class="answer"> <p>β
Lobefins </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> Q 69: In 1938, a lobe-fin called β¦β¦β¦ fish was caught in South Africa which was thought to be extinct. </div>
<div class="answer"> <p>β
Coelacanth </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> Q 70: Amphibians were evolved to ........ </div>
<div class="answer"> <p>β
Reptiles </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> Q 71: β¦β¦β¦ were present but they all fell to form coal deposits slowly. </div>
<div class="answer"> <p>β
Giant ferns (Pteridophytes) </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> Q 72: 200 mya, some of the land reptiles went back into water to evolve into fish-like reptiles such as </div>
<div class="answer"> <p>β
<i>Ichthyosaurs</i> </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> Q 73: β¦β¦β¦β¦ was the largest dinosaur. </div>
<div class="answer"> <p>β
<i>Tyrannosaurus rex</i> </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> Q 74: About β¦β¦.β¦. mya, dinosaurs suddenly disappeared. </div>
<div class="answer"> <p>β
65 </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> Q 75: Due to continental drift, β¦β¦β¦β¦β¦. survived because of lack of competition from any other mammals. </div>
<div class="answer"> <p>β
Australian marsupials </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> Q 76: 15 mya, there were Ape-like <i>Dryopithecus</i> and man-like β¦β¦β¦β¦β¦. </div>
<div class="answer"> <p>β
<i>Ramapithecus</i> </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> Q 77: 2 mya, β¦β¦β¦β¦. lived in East African grass lands who hunted with stone weapons and ate fruits. </div>
<div class="answer"> <p>β
<i>Australopithecines</i> </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> Q 78: Which is not correct about <i>Homo habilis</i>? <br> First human-like being (hominid). <br> Buried their dead. <br> Brain capacity was 650-800 cc. <br> Did not eat meat. </div>
<div class="answer"> <p>β
Buried their dead </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> Q 79: <i>Homo erectus</i> evolved around 1.5 mya and its brain capacity was ....... </div>
<div class="answer"> <p>β
900 cc </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> Q 80: Which is not correct about Neanderthal man? <p> (a) Ate only fruits <br> (b) Evolved around 1 lakh - 40,000 yrs ago <br> (c) Brain capacity was 1400 cc. <br> (d) Lived in East & Central Asia. </div>
<div class="answer"> <p>β
(a) Ate only fruits </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> Q 81: The β¦β¦β¦β¦. were among the early humans who used hides for protection and clothing, and they also practiced burying their dead. </div>
<div class="answer"> <p>β
Neanderthals </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> Q 82: Which human species was evolved around 75,000 - 10,000 years ago? </div>
<div class="answer"> <p>β
<i>Homo sapiens</i> (Modern man) </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> Q 83: Pre-historic cave art developed about β¦β¦β¦β¦ years ago. </div>
<div class="answer"> <p>β
18,000 </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> Q 84: Based on human evolution, agriculture & settlements were started β¦β¦β¦. years ago. </div>
<div class="answer"> <p>β
10,000 </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> Q 85: Fill in the blank: <br> <i>Dryopithecus</i> β <i>Ramapithecus</i> β β¦β¦β¦β¦β¦. β <i>Homo habilis</i> β <i>Homo erectus</i> β <i>Neanderthal</i> β <i>Homo sapiens</i>. </div>
<div class="answer"> <p>β
<i>Australopithecines</i> </div>
<button class="answer-button">View Answer</button>
</div>
<!--
<div class="box">
<div class="question"> Q 86: Question </div>
<div class="answer"> <p>β
............. </div>
<button class="answer-button">View Answer</button>
</div>
-->
<script>
// Get all the answer buttons
const answerButtons = document.querySelectorAll('.answer-button');
// Add a click event listener to each answer button
answerButtons.forEach(button => {
button.addEventListener('click', () => {
// Get the answer section for this button
const answerSection = button.previousElementSibling;
// Toggle the answer section's visibility
answerSection.classList.toggle('visible');
// Change the button text to "Hide Answer" or "View Answer"
if (answerSection.classList.contains('visible')) {
button.textContent = 'Hide Answer';
button.classList.add('hide-answer');
} else {
button.textContent = 'View Answer';
button.classList.remove('hide-answer');
}
});
});
</script>
<html>
<head>
<style>
.special-paragraph {
margin-bottom: -10px; /* Adjust this value to reduce the space */
color: #333333;
font-family: Arial, sans-serif;
font-size: 23px;
font-weight: bold;
line-height: 1.5;
padding: 7px;
text-align: center;
border-radius: 10px;
}
.green-bg {
background-color: #ddffd9; /* Green background */
}
.blue-bg {
background-color: #b0eaff; /* Blue background */
}
</style>
</head>
<body>
<p class="special-paragraph green-bg">
<a href="https://www.bankofbiology.com/2020/08/neet-entrance-basic-level-t-10-online.html" style="color: green;"> π Do an Online Test </a>
</p>
<p class="special-paragraph blue-bg">
<a href="https://www.bankofbiology.com/p/question-bank.html" style="color: blue;"> π Questions from other chapters </a>
</p>
</body>
</html>
<div class="blogger-post-footer"><p> Β© copyright 2024 β All rights reserved </p>
<a href=βhttps://www.bankofbiology.comβ>bankofbiology.com</a></div>Abu Raniyahttp://www.blogger.com/profile/14189496606355139812noreply@blogger.com0tag:blogger.com,1999:blog-6823671394482492613.post-52286183308149696392023-12-24T20:39:00.036+05:302024-01-01T18:58:15.470+05:30Molecular Basis of Inheritance | Class 12 | One-Word Answer type Questions | Topic - wise<!DOCTYPE html>
<html>
<head>
<title>Example Webpage</title>
<style>
body {
user-select: none; /* Prevent selection of text */
-moz-user-select: none; /* Firefox */
-webkit-user-select: none; /* Safari and Chrome */
-ms-user-select: none; /* Internet Explorer/Edge */
}
h1 {
user-select: text; /* Allow selection of title */
}
</style>
</head>
<p style="font-size: 22px; font-family: Arial; text-align: center; color: #0c8a7d;"> <b> Topic 1: THE DNA </b> </p>
<style>
/* Customize the box style */
.box {
background-color: #f2feff;
border: 1px solid #217f71;
border-radius: 5px;
padding: 10px;
margin-bottom: 10px;
margin-right: -7px;
margin-left: -7px;
}
/* Customize the question style */
.question {
font-size: 17px;
font-weight: bold;
color: #3d454a;
font-family: Roboto;
margin-bottom: 10px;
}
/* Customize the answer style */
.answer {
font-size: 18px;
font-weight: normal;
font-family: Roboto;
margin-bottom: 10px;
}
/* Hide the answer by default */
.answer {
display: none;
}
/* Customize the view/hide answer button */
.answer-button {
background-color: #4CAF50;
border: none;
border-radius: 5px;
color: white;
padding: 8px 16px;
text-align: center;
text-decoration: none;
display: inline-block;
font-size: 18px;
margin-bottom: 1px;
cursor: pointer;
}
/* Style the button differently when it changes to "Hide Answer" */
.answer-button.hide-answer {
background-color: #f44336;
}
/* Show the answer when the visible class is added */
.answer.visible {
display: block;
}
.table-text {
display: grid;
grid-template-columns: 50% 50%;
grid-gap: none;
margin-top: 5px;
border-collapse: collapse;
}
.table-text-2 {
display: grid;
grid-template-columns: 33.33% 33.33% 33.33%;
grid-gap: none;
margin-top: 5px;
border-collapse: collapse;
}
.table-text-header,
.table-text-cell {
padding: 5px;
border: 1px solid black;
text-align: left;
}
.table-text-header {
font-weight: bold;
text-align: center;
}
.no-break {
white-space: nowrap;
}
.tab {
text-indent: 40px; /* Adjust the value as per your preference */
}
</style>
<div class="box">
<div class="question">Q 1: DNA and RNA are the polymer of </div>
<div class="answer"><p>β
Nucleotides </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question">Q 2: The length of DNA is usually defined as number of β¦β¦β¦β¦β¦. present in it. </div>
<div class="answer"><p>β
Nucleotides </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question">Q 3: Π€ 174 (a bacteriophage) has β¦β¦.. nucleotides. </div>
<div class="answer"><p>β
5386 </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> Q 4: Bacteriophage lambda has β¦β¦β¦ base pairs (bp). </div>
<div class="answer"> <p>β
48502 </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question">Q 5: Number of base pairs in <i>E. coli</i> DNA is </div>
<div class="answer"><p>β
4.6x10<sup>6</sup> bp </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> Q 6: Haploid content of human DNA is </div>
<div class="answer"> <p>β
3.3x10<sup>9</sup> bp </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question">Q 7: A nucleotide has 3 components such as a nitrogenous base, a pentose sugar and a β¦β¦β¦.. </div>
<div class="answer"><p>β
Phosphate group </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> Q 8: The pentose sugar present in DNA is deoxyribose whereas in RNA is β¦β¦β¦β¦. </div>
<div class="answer"> <p>β
Ribose </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question">Q 9: Adenine (A) and Guanine (G) are the nitrogen bases that belongs to </div>
<div class="answer"><p>β
Purines </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> Q 10: Pyrimidines are a group of nitrogen bases that includes Cytosine (C), Thymine (T) and β¦β¦β¦.. </div>
<div class="answer"> <p>β
Uracil (U) </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question">Q 11: The nitrogen base present in RNA instead of thymine is </div>
<div class="answer"><p>β
Uracil </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> Q 12: Thymine is also called </div>
<div class="answer"> <p>β
5-methyl Uracil </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question">Q 13: A nitrogenous base is linked to the OH of 1' C pentose sugar through an β¦β¦β¦β¦. to form nucleoside. </div>
<div class="answer"><p>β
N-glycosidic linkage </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> Q 14: A phosphate group is linked to OH of 5' C of a nucleoside through β¦β¦β¦β¦.. to form nucleotide. </div>
<div class="answer"> <p>β
Phosphoester linkage </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question">Q 15: In RNA, each nucleotide has an additional β¦β¦β¦β¦ at 2' C of the ribose. </div>
<div class="answer"><p>β
βOH group </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> Q 16: 2 nucleotides are linked through 3β-5β phosphodiester bond to form </div>
<div class="answer"> <p>β
Dinucleotide </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question">Q 17: When more nucleotides are linked, it forms β¦β¦β¦.. </div>
<div class="answer"><p>β
Polynucleotide </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> Q 18: Who first identified DNA and named it Nuclein? </div>
<div class="answer"> <p>β
Friedrich Miescher </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question">Q 19: Double helix model of DNA was proposed by </div>
<div class="answer"><p>β
James Watson & Francis Crick </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> Q 20: Double helix model of DNA was based on X-ray diffraction data produced by </div>
<div class="answer"> <p>β
Maurice Wilkins & Rosalind Franklin </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question">Q 21: DNA is made of 2 β¦β¦β¦β¦β¦. chains coiled in a right-handed fashion. </div>
<div class="answer"><p>β
Polynucleotide </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> Q 22: Backbone of DNA is formed of sugar and β¦β¦β¦β¦. </div>
<div class="answer"> <p>β
Phosphates </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question">Q 23: In DNA, one chain has the polarity 5ββ3β and the other has 3ββ5β. This arrangement is called </div>
<div class="answer"><p>β
Anti-parallel polarity </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> Q 24: The bases in 2 DNA strands are paired through </div>
<div class="answer"> <p>β
H-bonds </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question">Q 25: Adenine pairs with Thymine through 2 hydrogen bonds whereas cytosine pairs with guanine through β¦β¦β¦. </div>
<div class="answer"><p>β
3 hydrogen bonds </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> Q 26: In DNA, the ratio of A to T and the ratio of G to C are equal. This is called </div>
<div class="answer"> <p>β
Erwin Chargaffβs rule </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question">Q 27: Pitch of DNA helix is about β¦β¦β¦β¦ </div>
<div class="answer"><p>β
3.4 nm (34 Γ
) </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> Q 28: Number of base pairs in each turn of the DNA helix is </div>
<div class="answer"> <p>β
10 </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question">Q 29: In DNA, distance between adjacent base pairs is </div>
<div class="answer"><p>β
0.34 nm (3.4 Γ
) </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> Q 30: Number of base pairs in human DNA is </div>
<div class="answer"> <p>β
6.6 x 10<sup>9</sup> </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> Q 31: Length of human DNA is about </div>
<div class="answer"> <p>β
2.2 m </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> Q 32: The genetic information flows from DNA β RNA β Protein. This is called </div>
<div class="answer"> <p>β
Central dogma of Molecular Biology </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> Q 33: Central dogma of Molecular Biology is proposed by </div>
<div class="answer"> <p>β
Francis Crick </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> Q 34: In some viruses, flow of information is in reverse direction (from RNA to DNA). It is called </div>
<div class="answer"> <p>β
Reverse transcription </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> Q 35: In prokaryotes such as <i>E. coli</i>, the negatively charged DNA is held with some positively charged proteins in a region called </div>
<div class="answer"> <p>β
Nucleoid </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> Q 36: In eukaryotes, there is a set of positively charged, basic proteins called </div>
<div class="answer"> <p>β
Histones </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> Q 37: Histones are rich in positively charged basic amino acid residues called </div>
<div class="answer"> <p>β
lysines and arginines </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> Q 38: Eight histones form ....... </div>
<div class="answer"> <p>β
Histone octamer </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> Q 39: Negatively charged DNA is wrapped around histone octamer to give β¦β¦β¦β¦β¦ </div>
<div class="answer"> <p>β
Nucleosome </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> Q 40: A typical nucleosome contains ....... bp. </div>
<div class="answer"> <p>β
200 bp </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> Q 41: Total number of nucleosomes in human is about </div>
<div class="answer"> <p>β
3.3 x 10<sup>7</sup> </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> Q 42: Nucleosomes constitute the repeating unit to form </div>
<div class="answer"> <p>β
Chromatin </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> Q 43: Nucleosomes in chromatin is like β¦β¦β¦β¦. when viewed under electron microscope. </div>
<div class="answer"> <p>β
Beads-on-string </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> Q 44: The beads-on-string structure in chromatin is packaged to form chromatin fibres that are further coiled and condensed at metaphase stage to form </div>
<div class="answer"> <p>β
Chromosomes </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> Q 45: Higher level packaging of chromatin in eukaryotes requires </div>
<div class="answer"> <p>β
Non-histone chromosomal (NHC) proteins </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> Q 46: Loosely packed, light stained and transcriptionally active region of chromatin is called </div>
<div class="answer"> <p>β
Euchromatin </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> Q 47: Densely packed, dark stained and inactive region of chromatin is called </div>
<div class="answer"> <p>β
Heterochromatin </div>
<button class="answer-button">View Answer</button>
</div>
<p style="font-size: 22px; font-family: Arial; text-align: center; color: #0c8a7d;"> <b> Topic 2: THE SEARCH FOR GENETIC MATERIAL </b> </p>
<div class="box">
<div class="question"> Q 48: Transforming principle experiment was first conducted by β¦β¦β¦β¦ </div>
<div class="answer"> <p>β
Frederick Griffith </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> Q 49: <i>Streptococcus pneumoniae</i> has 2 strains such as Smooth (S) strain and β¦β¦β¦β¦. </div>
<div class="answer"> <p>β
Rough (R) strain </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> Q 50: Which strain of <i>Streptococcus pneumoniae</i> has polysaccharide mucus coat and causes pneumonia? </div>
<div class="answer"> <p>β
Smooth (S) strain </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> Q 51: R strain bacteria and β¦β¦β¦. bacteria cannot cause pneumonia in mice. </div>
<div class="answer"> <p>β
Heat killed S strain </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> Q 52: When Griffith injected a mixture of heat killed S strain andβ¦β¦β¦β¦, mice died. </div>
<div class="answer"> <p>β
Live R-strain </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> Q 53: Griffith named the substance transferred from heat-killed S-strain to R-strain as </div>
<div class="answer"> <p>β
Transforming principle </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> Q 54: Oswald Avery, Colin MacLeod & Maclyn McCarty proved that the transforming principle in Griffithβs experiment is β¦β¦β¦β¦. </div>
<div class="answer"> <p>β
DNA </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> Q 55: Who proved that DNA is the genetic material by conducting experiment using bacteriophage viruses and <i>E. coli</i>? </div>
<div class="answer"> <p>β
Alfred Hershey & Martha Chase </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> Q 56: In Hershey-Chase experiment, viruses grown in P<sup>32</sup> got radioactive DNA and viruses grown in S<sup>35</sup> got </div>
<div class="answer"> <p>β
Radioactive protein </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> Q 57: In β¦β¦... experiment, bacteria infected with viruses having radioactive DNA were radioactive. This proves that DNA is the genetic material. </div>
<div class="answer"> <p>β
Hershey-Chase </div>
<button class="answer-button">View Answer</button>
</div>
<p style="font-size: 22px; font-family: Arial; text-align: center; color: #0c8a7d;"> <b> Topic 3: PROPERTIES OF GENETIC MATERIAL (DNA v/s RNA) </b> </p>
<div class="box">
<div class="question"> Q 58: Single stranded structure and presence of β¦β¦β¦β¦. and 2β-OH in ribose sugar are the important reasons for the mutability or high reactivity of RNA. </div>
<div class="answer"> <p>β
Uracil </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> Q 59: Viruses such as Q.B bacteriophage, Tobacco Mosaic Virus etc. mutate and evolve faster. This is because their genetic material is β¦β¦β¦. </div>
<div class="answer"> <p>β
RNA </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> Q 60: Which experiment gives a proof for the stability of DNA? </div>
<div class="answer"> <p>β
Griffithβs experiment </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> Q 61: For the storage of genetic information, β¦β¦... is better due to its stability. </div>
<div class="answer"> <p>β
DNA </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> Q 62: For the transmission of genetic information, β¦β¦β¦ is better. </div>
<div class="answer"> <p>β
RNA </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> Q 63: The first genetic material was β¦β¦β¦. </div>
<div class="answer"> <p>β
RNA </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> Q 64: DNA evolved from β¦β¦β¦. for stability. </div>
<div class="answer"> <p>β
RNA </div>
<button class="answer-button">View Answer</button>
</div>
<p style="font-size: 22px; font-family: Arial; text-align: center; color: #0c8a7d;"> <b> Topic 4: REPLICATION </b> </p>
<div class="box">
<div class="question"> Q 65: The copying of DNA from parental DNA is called </div>
<div class="answer"> <p>β
Replication </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> Q 66: Semi-conservative model of DNA replication was proposed by β¦β¦β¦β¦ </div>
<div class="answer"> <p>β
Watson & Crick </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> Q 67: After replication, each DNA molecule would have one parental and one new strand. This model of replication is called β¦β¦β¦β¦β¦. </div>
<div class="answer"> <p>β
Semi-conservative model </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> Q 68: β¦β¦β¦β¦. experimentally proved Semi-conservative model. </div>
<div class="answer"> <p>β
Matthew Meselson & Franklin Stahl </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> Q 69: Meselson and Stahl grew <i>E. coli</i> in β¦β¦β¦β¦ medium. As a result, newly synthesised DNA was heavier. </div>
<div class="answer"> <p>β
<sup>15</sup>NH<sub>4</sub>Cl </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> Q 70: In Meselson-Stahl experiment, heavy DNA can be distinguished from normal DNA (light DNA or <sup>14</sup>N DNA) by centrifugation in a β¦β¦β¦β¦ </div>
<div class="answer"> <p>β
Caesium chloride (CsCl) density gradient </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> Q 71: When <i>E. coli</i> cells from 15N medium were transferred to <sup>14</sup>NH<sub>4</sub>Cl medium, DNA of next generation was β¦β¦.. type. </div>
<div class="answer"> <p>β
Hybrid type (<sup>15</sup>N -<sup>14</sup>N) </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> Q 72: Taylor & colleagues (1958) performed experiments on β¦β¦β¦ using radioactive thymidine to detect distribution of newly synthesized DNA in the chromosomes. </div>
<div class="answer"> <p>β
<i>Vicia faba</i> (faba beans) </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> Q 73: In living cells, such as <i>E. coli</i>, replication requires a set of enzymes such as </div>
<div class="answer"> <p>β
<i>DNA-dependent DNA polymerases</i> </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> Q 74: <i>DNA polymerases</i> use DNA strands as templates to catalyse polymerisation of </div>
<div class="answer"> <p>β
Deoxynucleotides </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> Q 75: There is a definite region in DNA where the replication originates. Such regions are called β¦β¦β¦. </div>
<div class="answer"> <p>β
Origin of replication </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> Q 76: In recombinant DNA procedures, the β¦β¦β¦. provide the origin of replication. </div>
<div class="answer"> <p>β
Vectors </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> Q 77: Replication occurs within a small opening of the DNA helix. It is called </div>
<div class="answer"> <p>β
Replication fork </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> Q 78: During replication, <i>DNA polymerases</i> catalyse polymerisation in β¦β¦β¦β¦ direction. </div>
<div class="answer"> <p>β
5'β3' </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> Q 79: DNA replication is continuous on the template with the polarity ....... </div>
<div class="answer"> <p>β
3'β5' </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> Q 80: The discontinuously synthesised DNA fragments are later joined by the enzyme ......... </div>
<div class="answer"> <p>β
<i>DNA ligase</i> </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> Q 81: <i>E. coli</i> completes the replication within </div>
<div class="answer"> <p>β
18 minutes </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> Q 82: In eukaryotes, the replication takes place at β¦β¦β¦. of the cell-cycle. </div>
<div class="answer"> <p>β
S-phase </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> Q 83: Failure in cell division after DNA replication results in </div>
<div class="answer"> <p>β
Polyploidy </div>
<button class="answer-button">View Answer</button>
</div>
<p style="font-size: 22px; font-family: Arial; text-align: center; color: #0c8a7d;"> <b> Topic 5: TRANSCRIPTION </b> </p>
<div class="box">
<div class="question"> Q 84: The process of copying genetic information from one strand of the DNA into RNA is called </div>
<div class="answer"> <p>β
Transcription </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> Q 85: In transcription, adenine pairs with β¦β¦β¦ instead of thymine. </div>
<div class="answer"> <p>β
Uracil </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> Q 86: During transcription, the β¦β¦β¦β¦β¦. enzyme catalyzes the polymerization only in 5ββ3βdirection. </div>
<div class="answer"> <p>β
<i>DNA-dependent RNA polymerase</i> </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> Q 87: During transcription, 3ββ5β strand acts as template strand and 5ββ3β acts as </div>
<div class="answer"> <p>β
Coding strand </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> Q 88: The segment of DNA between the sites of initiation and termination of transcription is called </div>
<div class="answer"> <p>β
Transcription Unit </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> Q 89: In a transcription unit, the binding site for <i>RNA polymerase</i> located towards 5'-end is called </div>
<div class="answer"> <p>β
Promoter </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> Q 90: The region between promoter and terminator where transcription takes place is called </div>
<div class="answer"> <p>β
Structural gene </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> Q 91: In a transcription unit, the site towards 3'-end where transcription stops is called </div>
<div class="answer"> <p>β
Terminator </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> Q 92: β¦β¦β¦. is a functional unit of inheritance. </div>
<div class="answer"> <p>β
Gene </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> Q 93: Gene is the DNA sequence coding for β¦β¦β¦... </div>
<div class="answer"> <p>β
RNA </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> Q 94: A segment of DNA coding for a polypeptide during protein synthesis is called </div>
<div class="answer"> <p>β
Cistron </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> Q 95: In structural genes of eukaryotes, the coding sequences (exons or expressed sequences) are interrupted by introns (intervening sequences). They are called </div>
<div class="answer"> <p>β
Monocistronic structural genes (split genes) </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> Q 96: Polycistronic structural genes are seen in </div>
<div class="answer"> <p>β
Prokaryotes </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> Q 97: In bacteria (Prokaryotes), synthesis of all types of RNA are catalysed by a single enzyme called </div>
<div class="answer"> <p>β
<i>RNA polymerase</i> </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> Q 98: For the initiation of transcription, an initiation factor called β¦β¦β¦β¦ binds with <i>RNA polymerase</i> which helps the enzyme to bind at the promoter site of DNA. </div>
<div class="answer"> <p>β
Ο factor </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> Q 99: During transcription, the substrates used for the polymerisation are β¦β¦β¦. </div>
<div class="answer"> <p>β
Nucleoside triphosphates </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> Q 100: During termination of transcription, a β¦β¦β¦β¦β¦ binds to the <i>RNA polymerase</i> and terminates the transcription. </div>
<div class="answer"> <p>β
Ο factor (Termination factor) </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> Q 101: The enzyme that transcribes rRNAs (28S, 18S & 5.8S) is </div>
<div class="answer"> <p>β
<i>RNA polymerase I</i> </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> Q 102: The enzyme β¦β¦β¦β¦β¦β¦ transcribes the heterogeneous nuclear RNA (hnRNA). </div>
<div class="answer"> <p>β
<i>RNA polymerase II </i></div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> Q 103: The precursor of mRNA or primary transcripts is called </div>
<div class="answer"> <p>β
Heterogeneous nuclear RNA (hnRNA) </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> Q 104: tRNA, 5S rRNA and snRNAs (small nuclear RNAs) are transcribed by </div>
<div class="answer"> <p>β
<i>RNA polymerase III</i> </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> Q 105: Splicing is a process in which β¦β¦β¦ are removed from hnRNA and exons are spliced (joined) together. </div>
<div class="answer"> <p>β
Introns </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> Q 106: In Capping, a nucleotide β¦β¦β¦. is added to the 5β end of hnRNA. </div>
<div class="answer"> <p>β
Methyl guanosine triphosphate </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> Q 107: During β¦β¦β¦β¦., 200 to 300 adenylate residues are added at 3β-end of hnRNA. </div>
<div class="answer"> <p>β
Tailing (Polyadenylation) </div>
<button class="answer-button">View Answer</button>
</div>
<p style="font-size: 22px; font-family: Arial; text-align: center; color: #0c8a7d;"> <b> Topic 6: GENETIC CODE </b> </p>
<div class="box">
<div class="question"> Q 108: The sequence of nucleotides (nitrogen bases) in mRNA that contains information for protein synthesis is called </div>
<div class="answer"> <p>β
Genetic code </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> Q 109: The sequence of 3 bases determining a single amino acid is called </div>
<div class="answer"> <p>β
Codon </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> Q 110: β¦β¦β¦.. suggested that for coding 20 amino acids, the code should be made up of 3 nucleotides. </div>
<div class="answer"> <p>β
George Gamow </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> Q 111: β¦β¦β¦β¦β¦ developed the chemical method in synthesizing RNA molecules with defined combinations of bases. </div>
<div class="answer"> <p>β
Har Gobind Khorana </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> Q 112: Who developed cell-free system for protein synthesis? </div>
<div class="answer"> <p>β
Marshall Nirenberg </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> Q 113: Which enzyme is used to polymerize RNA with defined sequences in a template independent manner? </div>
<div class="answer"> <p>β
<i>Severo Ochoa (polynucleotide phosphorylase)</i> enzyme </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> Q 114: How many codons code for amino acids? </div>
<div class="answer"> <p>β
61 </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> Q 115: Which of the following is not a Stop codon (Termination codons? <br> UAA, AUG, UAG, UGA. </div>
<div class="answer"> <p>β
AUG </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> Q 116: Some amino acids are coded by more than one codon. Such codons are called </div>
<div class="answer"> <p>β
Degenerate codons </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> Q 117: AUG has dual functions. It codes for Methionine and acts as β¦β¦β¦.. </div>
<div class="answer"> <p>β
Initiator codon </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> Q 118: Insertion or deletion of one or two bases changes the reading frame from the point of insertion or deletion. It is called </div>
<div class="answer"> <p>β
Frame-shift insertion or deletion mutations </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> Q 119: Name the RNA that provides template for translation (protein synthesis). </div>
<div class="answer"> <p>β
mRNA (messenger RNA) </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> Q 120: β¦β¦β¦β¦β¦ has structural and catalytic role during translation. </div>
<div class="answer"> <p>β
rRNA (ribosomal RNA) </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> Q 121: Which RNA brings amino acids for protein synthesis and reads the genetic code? </div>
<div class="answer"> <p>β
tRNA (transfer RNA) </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> Q 122: tRNA is also called β¦β¦β¦β¦.. </div>
<div class="answer"> <p>β
sRNA (soluble RNA) </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> Q 123: β¦β¦β¦β¦ postulated about an adapter molecule that can read the code and to link with amino acids. </div>
<div class="answer"> <p>β
Francis Crick </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> Q 124: Which RNA has a role of an adapter molecule? </div>
<div class="answer"> <p>β
tRNA </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> Q 125: tRNA has an β¦β¦β¦β¦. that has bases complementary to the codon. </div>
<div class="answer"> <p>β
Anticodon loop </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> Q 126: Secondary structure of tRNA looks like a ......... </div>
<div class="answer"> <p>β
Clover-leaf </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> Q 127: In actual structure, the tRNA is a compact molecule which looks like β¦β¦β¦β¦β¦ </div>
<div class="answer"> <p>β
inverted L </div>
<button class="answer-button">View Answer</button>
</div>
<p style="font-size: 22px; font-family: Arial; text-align: center; color: #0c8a7d;"> <b> Topic 7: TRANSLATION (PROTEIN SYNTHESIS) </b> </p>
<div class="box">
<div class="question"> Q 128: The process of polymerisation of amino acids to form a polypeptide based on the sequence of codons in mRNA is called β¦β¦β¦β¦β¦. </div>
<div class="answer"> <p>β
Translation </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> Q 129: Translation takes place in </div>
<div class="answer"> <p>β
Ribosomes </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> Q 130: Ribosome consists of structural RNAs and about β¦β¦β¦... types of proteins. </div>
<div class="answer"> <p>β
80 </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> Q 131: Ribosome also acts as a catalyst for the formation of β¦β¦β¦β¦β¦ between amino acids. </div>
<div class="answer"> <p>β
Peptide bond </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> Q 132: β¦β¦β¦β¦. in bacteria is a ribozyme. </div>
<div class="answer"> <p>β
23S rRNA </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> Q 133: Amino acids are activated in presence of ATP and linked to their cognate tRNA. It is called </div>
<div class="answer"> <p>β
Charging (aminoacylation) of tRNA </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> Q 134: During the initiation of translation, ribosome binds to the mRNA at the start codon called </div>
<div class="answer"> <p>β
AUG </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> Q 135: Start codon is recognised by the initiator tRNA that carries the amino acid β¦β¦β¦β¦.. </div>
<div class="answer"> <p>β
Methionine </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> Q 136: During elongation process of translation, charged tRNA sequentially bind to the appropriate codon in mRNA by forming complementary base pairs with β¦β¦β¦ </div>
<div class="answer"> <p>β
tRNA anticodon </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> Q 137: β¦β¦β¦β¦. moves from codon to codon along the mRNA. </div>
<div class="answer"> <p>β
Ribosome </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> Q 138: When a β¦β¦β¦β¦. binds to stop codon, the translation terminates. </div>
<div class="answer"> <p>β
Release factor </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> Q 139: An mRNA has additional sequences that are not translated. It is called </div>
<div class="answer"> <p>β
Untranslated regions (UTR) </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> Q 140: β¦β¦β¦. are required for efficient translation process. </div>
<div class="answer"> <p>β
UTRs </div>
<button class="answer-button">View Answer</button>
</div>
<p style="font-size: 22px; font-family: Arial; text-align: center; color: #0c8a7d;"> <b> Topic 8: REGULATION OF GENE EXPRESSION </b> </p>
<div class="box">
<div class="question"> Q 141: In the following levels of gene expression, which is absent in prokaryotes? <br> Transcriptional level <br>Processing level <br> Transport of mRNA from nucleus to the cytoplasm <br> Translational level </div>
<div class="answer"> <p>β
Processing level </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> Q 142: In <i>E. coli</i>, the β¦β¦β¦β¦β¦ enzyme hydrolyses lactose into galactose & glucose. </div>
<div class="answer"> <p>β
<i>Beta-galactosidase</i> </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> Q 143: If a substrate is added to growth medium of bacteria, a set of genes is switched on to metabolize it. It is called </div>
<div class="answer"> <p>β
Induction </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> Q 144: When a metabolite (product) is added, the genes to produce it are turned off. This is called </div>
<div class="answer"> <p>β
Repression </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> Q 145: A group of genes regulating a metabolic reaction is called β¦β¦β¦. </div>
<div class="answer"> <p>β
Operon </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> Q 146: β¦β¦β¦β¦. is an operon that controls lactose metabolism in bacteria. </div>
<div class="answer"> <p>β
<i>Lac</i> operon </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> Q 147: <i>Lac</i> operon was first elucidated by </div>
<div class="answer"> <p>β
Francois Jacob and Jacque Monod </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> Q 148: In <i>lac</i> operon, a β¦β¦β¦β¦ is regulated by a common promoter and regulatory gene. </div>
<div class="answer"> <p>β
Polycistronic structural gene </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> Q 149: In <i>Lac</i> operon, the gene that codes for repressor protein is called </div>
<div class="answer"> <p>β
Regulatory or inhibitor (i) gene </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> Q 150: In <i>Lac</i> operon, there are 3 structural genes such as β¦β¦β¦β¦ </div>
<div class="answer"> <p>β
z, y a </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> Q 151: The z gene codes for β¦β¦β¦β¦β¦ that hydrolyses lactose to galactose and glucose. </div>
<div class="answer"> <p>β
<i>κ΅-galactosidase</i> </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> Q 152: The y gene codes for <i>Permease</i> that increases permeability of the cell to ......... </div>
<div class="answer"> <p>β
κ΅-galactosides (lactose) </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> Q 153: The a gene codes for an enzyme .......... </div>
<div class="answer"> <p>β
<i>Transacetylase</i> </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> Q 154: If there is no β¦β¦β¦ <i>lac</i> operon remains switched off. </div>
<div class="answer"> <p>β
Lactose (inducer) </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> Q 155: The repressor protein binds to the β¦β¦β¦ region and blocks RNA polymerase movement so that structural genes are not expressed. </div>
<div class="answer"> <p>β
Operator </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> Q 156: If lactose or allolactose is provided in the growth medium, it is transported into bacterial cells by the action of </div>
<div class="answer"> <p>β
<i>Permease</i> </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> Q 157: β¦β¦β¦. binds with repressor protein, so that repressor protein cannot bind to operator region. </div>
<div class="answer"> <p>β
Lactose (inducer) </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> Q 158: A very low-level expression of lac operon is always present to uptake β¦β¦β¦ into the cells. </div>
<div class="answer"> <p>β
Lactose </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> Q 159: In <i>lac</i> operon, glucose or galactose cannot act as β¦β¦β¦. </div>
<div class="answer"> <p>β
Inducers </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> Q 160: Regulation of <i>lac</i> operon by repressor is called </div>
<div class="answer"> <p>β
Negative regulation </div>
<button class="answer-button">View Answer</button>
</div>
<p style="font-size: 22px; font-family: Arial; text-align: center; color: #0c8a7d;"> <b> Topic 9: HUMAN GENOME PROJECT (HGP) </b> </p>
<div class="box">
<div class="question"> Q 161: The entire DNA in the haploid set of chromosomes of an organism is called a .......... </div>
<div class="answer"> <p>β
Genome </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> Q 162: Human genome contains about ........ </div>
<div class="answer"> <p>β
3x10<sup>9</sup> bp </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> Q 163: The first mega project for the sequencing of nucleotides and mapping of the genes in human genome was </div>
<div class="answer"> <p>β
Human Genome Project (HGP) </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> Q 164: HGP was coordinated by U.S. Department of Energy and the .............. </div>
<div class="answer"> <p>β
National Institute of Health </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> Q 165: ELSI stands for β¦β¦β¦. </div>
<div class="answer"> <p>β
Ethical, legal and social issues </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> Q 166: There are 2 major approaches in methodologies of HGP such as Expressed Sequence Tags (ESTs) and β¦β¦. </div>
<div class="answer"> <p>β
Sequence annotation </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> Q 167: The approach focused on identifying all the genes that are expressed as RNA is </div>
<div class="answer"> <p>β
Expressed Sequence Tags (ESTs) </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> Q 168: The approach of sequencing of whole genome including all the coding and non-coding sequence and later assigning different regions in the sequence with functions is </div>
<div class="answer"> <p>β
Sequence annotation </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> Q 169: In HGP, DNA fragments were cloned in a host (bacteria & yeast) using vectors such as BAC and β¦β¦.. for amplification. </div>
<div class="answer"> <p>β
YAC (Yeast Artificial Chromosomes) </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> Q 170: BAC stands for </div>
<div class="answer"> <p>β
Bacterial Artificial Chromosomes </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> Q 171: The DNA fragments were sequenced using automated DNA sequencers that worked on the principle of a method developed by </div>
<div class="answer"> <p>β
Frederick Sanger </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> Q 172: β¦β¦β¦ has also developed method for sequencing of amino acids in proteins. </div>
<div class="answer"> <p>β
Sanger </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> Q 173: HGP was closely associated with the rapid development of a new area in biology called </div>
<div class="answer"> <p>β
Bioinformatics </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> Q 174: Of the 24 chromosomes (22 autosomes and X & Y), the last sequenced one is </div>
<div class="answer"> <p>β
Chromosome 1 </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> Q 175: Human genome contains β¦β¦β¦β¦. million nucleotide bases. </div>
<div class="answer"> <p>β
3164.7 </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> Q 176: Total number of genes in human genome is about </div>
<div class="answer"> <p>β
30,000 </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> Q 177: In human genome, average gene consists of β¦β¦β¦β¦ bases. </div>
<div class="answer"> <p>β
3000 </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> Q 178: Largest known human gene is β¦β¦β¦. on X-chromosome that contains 2.4 million bases. </div>
<div class="answer"> <p>β
Dystrophin </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> Q 179: β¦β¦β¦.. nucleotide bases are same in all people. </div>
<div class="answer"> <p>β
99.9% </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> Q 180: According to the Human Genome Project, the human chromosome with the least number of genes is the β¦β¦β¦β¦ which has about 231 genes. </div>
<div class="answer"> <p>β
Y chromosome </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> Q 181: The human chromosome with the greatest number of genes isβ¦β¦β¦β¦ which has about 2968 genes. </div>
<div class="answer"> <p>β
Chromosome 1 </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> Q 182: Less than β¦β¦ of the genome codes for proteins. </div>
<div class="answer"> <p>β
2% </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> Q 183: The stretches of DNA sequences of human genome that are repeated many times are called </div>
<div class="answer"> <p>β
Repeated (repetitive) sequences </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> Q 184: About 1.4 million locations in human genome have single-base DNA differences. They are called </div>
<div class="answer"> <p>β
SNPs (Single nucleotide polymorphism or snips) </div>
<button class="answer-button">View Answer</button>
</div>
<p style="font-size: 22px; font-family: Arial; text-align: center; color: #0c8a7d;"> <b> Topic 10: DNA FINGERPRINTING (DNA PROFILING) </b> </p>
<div class="box">
<div class="question"> Q 185: The technique to identify the similarities and differences of the DNA fragments of 2 individuals is called </div>
<div class="answer"> <p>β
DNA fingerprinting </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> Q 186: DNA fingerprinting was developed by </div>
<div class="answer"> <p>β
Alec Jeffreys </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> Q 187: The bulk DNA forms a major peak and the small peaks are called </div>
<div class="answer"> <p>β
Satellite DNA </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> Q 188: A DNA sequence which is tandemly repeated in many copy numbers is called </div>
<div class="answer"> <p>β
Variable number tandem repeats (VNTR) </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> Q 189: VNTR belongs to β¦β¦β¦.. DNA. </div>
<div class="answer"> <p>β
Mini-satellite </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> Q 190: The size of VNTR varies from </div>
<div class="answer"> <p>β
0.1 to 20 kb </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> Q 191: Any difference in the nucleotide sequence (inheritable mutation) observed in a population is called </div>
<div class="answer"> <p>β
DNA polymorphism </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> Q 192: The technique used in the procedure of DNA fingerprinting is </div>
<div class="answer"> <p>β
Southern Blotting Technique </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> Q 193: In DNA fingerprinting, digestion of DNA is carried by </div>
<div class="answer"> <p>β
<i>Restriction endonucleases</i> </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> Q 194: DNA fragments are separated by </div>
<div class="answer"> <p>β
Gel electrophoresis </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> Q 195: In DNA fingerprinting, DNA fragments are transferred (blotting) to synthetic membranes such as </div>
<div class="answer"> <p>β
Nitrocellulose or nylon </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> Q 196: In DNA fingerprinting, DNA fragments are hybridized using radioactive labelled β¦β¦β¦. </div>
<div class="answer"> <p>β
VNTR probe </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> Q 197: DNA fingerprint differs in everyone except in ......... </div>
<div class="answer"> <p>β
Monozygotic (identical) twins </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> Q 198: The sensitivity of the technique can be increased by use of </div>
<div class="answer"> <p>β
Polymerase chain reaction (PCR) </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> Q 199: β¦β¦β¦β¦β¦.. is used as a forensic tool to solve paternity, rape, murder etc. and for the diagnosis of genetic diseases </div>
<div class="answer"> <p>β
DNA fingerprinting </div>
<button class="answer-button">View Answer</button>
</div>
<!--
<div class="box">
<div class="question"> Q 200: Question </div>
<div class="answer"> <p>β
............. </div>
<button class="answer-button">View Answer</button>
</div>
-->
<script>
// Get all the answer buttons
const answerButtons = document.querySelectorAll('.answer-button');
// Add a click event listener to each answer button
answerButtons.forEach(button => {
button.addEventListener('click', () => {
// Get the answer section for this button
const answerSection = button.previousElementSibling;
// Toggle the answer section's visibility
answerSection.classList.toggle('visible');
// Change the button text to "Hide Answer" or "View Answer"
if (answerSection.classList.contains('visible')) {
button.textContent = 'Hide Answer';
button.classList.add('hide-answer');
} else {
button.textContent = 'View Answer';
button.classList.remove('hide-answer');
}
});
});
</script>
<html>
<head>
<style>
.special-paragraph {
margin-bottom: -10px; /* Adjust this value to reduce the space */
color: #333333;
font-family: Arial, sans-serif;
font-size: 23px;
font-weight: bold;
line-height: 1.5;
padding: 7px;
text-align: center;
border-radius: 10px;
}
.green-bg {
background-color: #ddffd9; /* Green background */
}
.blue-bg {
background-color: #b0eaff; /* Blue background */
}
</style>
</head>
<body>
<p class="special-paragraph green-bg">
<a href="https://www.bankofbiology.com/2020/08/neet-entrance-basic-level-t-10-online.html" style="color: green;"> π Do an Online Test </a>
</p>
<p class="special-paragraph blue-bg">
<a href="https://www.bankofbiology.com/p/question-bank.html" style="color: blue;"> π Questions from other chapters </a>
</p>
</body>
</html>
<div class="blogger-post-footer"><p> Β© copyright 2024 β All rights reserved </p>
<a href=βhttps://www.bankofbiology.comβ>bankofbiology.com</a></div>Abu Raniyahttp://www.blogger.com/profile/14189496606355139812noreply@blogger.com0tag:blogger.com,1999:blog-6823671394482492613.post-47603309477156999302023-12-16T21:51:00.016+05:302023-12-29T21:42:01.071+05:30Principles of Inheritance and Variation | Class 12 | One Word Answer Type Questions | Topic - wise<!DOCTYPE html>
<html>
<head>
<title>Example Webpage</title>
<style>
body {
user-select: none; /* Prevent selection of text */
-moz-user-select: none; /* Firefox */
-webkit-user-select: none; /* Safari and Chrome */
-ms-user-select: none; /* Internet Explorer/Edge */
}
h1 {
user-select: text; /* Allow selection of title */
}
</style>
</head>
<style>
/* Customize the box style */
.box {
background-color: #f2feff;
border: 1px solid #217f71;
border-radius: 5px;
padding: 10px;
margin-bottom: 10px;
margin-right: -7px;
margin-left: -7px;
}
/* Customize the question style */
.question {
font-size: 17px;
font-weight: bold;
color: #3d454a;
font-family: Roboto;
margin-bottom: 10px;
}
/* Customize the answer style */
.answer {
font-size: 18px;
font-weight: normal;
font-family: Roboto;
margin-bottom: 10px;
}
/* Hide the answer by default */
.answer {
display: none;
}
/* Customize the view/hide answer button */
.answer-button {
background-color: #4CAF50;
border: none;
border-radius: 5px;
color: white;
padding: 8px 16px;
text-align: center;
text-decoration: none;
display: inline-block;
font-size: 18px;
margin-bottom: 1px;
cursor: pointer;
}
/* Style the button differently when it changes to "Hide Answer" */
.answer-button.hide-answer {
background-color: #f44336;
}
/* Show the answer when the visible class is added */
.answer.visible {
display: block;
}
.table-text {
display: grid;
grid-template-columns: 50% 50%;
grid-gap: none;
margin-top: 5px;
border-collapse: collapse;
}
.table-text-2 {
display: grid;
grid-template-columns: 33.33% 33.33% 33.33%;
grid-gap: none;
margin-top: 5px;
border-collapse: collapse;
}
.table-text-header,
.table-text-cell {
padding: 5px;
border: 1px solid black;
text-align: left;
}
.table-text-header {
font-weight: bold;
text-align: center;
}
.no-break {
white-space: nowrap;
}
.tab {
text-indent: 40px; /* Adjust the value as per your preference */
}
</style>
<p style="font-size: 22px; font-family: Arial; text-align: center; color: #0c8a7d;"> <b> Topic 1: MENDELβS LAWS OF INHERITANCE </b> </p>
<div class="box">
<div class="question">Q 1: Study of inheritance, heredity and variation of characters is called β¦β¦β¦β¦. </div>
<div class="answer"><p>β
Genetics </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question">Q 2: Who is the Father of Genetics? </div>
<div class="answer"><p>β
Gregor Mendel </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> Q 3: Transmission of characters from parents to progeny is called β¦β¦β¦β¦. </div>
<div class="answer"> <p>β
Inheritance </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question">Q 4: Difference between parents and offspring is called </div>
<div class="answer"><p>β
Variation </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question">Q 5: Mendel conducted some hybridization experiments on </div>
<div class="answer"><p>β
Garden peas (<i>Pisum sativum</i>) </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> Q 6: Removal of anthers of one plant to avoid self-pollination is called </div>
<div class="answer"> <p>β
Emasculation </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question">Q 7: Mendel selected β¦β¦ pairs of true breeding pea varieties. </div>
<div class="answer"><p>β
7 </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> Q 8: Which of the following is a recessive trait? <p> Tall stem, Yellow pod, Round seed, Axial flower. </div>
<div class="answer"> <p>β
Yellow pod </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question">Q 9: A cross involving 2 plants differing in one character pair is called </div>
<div class="answer"><p>β
Monohybrid cross </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> Q 10: Monohybrid phenotypic ratio is </div>
<div class="answer"> <p>β
3:1 </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question">Q 11: Monohybrid genotypic ratio is </div>
<div class="answer"><p>β
1:2:1 </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> Q 12: Alternative forms of a gene are called ......... </div>
<div class="answer"> <p>β
Allele </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question">Q 13: The condition in which chromosome pair carries similar alleles of a gene is called </div>
<div class="answer"><p>β
Homozygous </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> Q 14: The condition in which chromosome pair carries dissimilar alleles of a gene is called </div>
<div class="answer"> <p>β
Heterozygous </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question">Q 15: The character which is expressed in heterozygous condition is β¦β¦β¦β¦β¦ </div>
<div class="answer"><p>β
Dominant character </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> Q 16: The character which is suppressed in heterozygous condition is β¦β¦β¦β¦β¦. </div>
<div class="answer"> <p>β
Recessive character </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question">Q 17: Physical expression of a character is called </div>
<div class="answer"><p>β
Phenotype </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> Q 18: Genetic constitution of a character is called </div>
<div class="answer"> <p>β
Genotype </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question">Q 19: A graphical representation to calculate probability of all genotypes of offspring in a genetic cross is called </div>
<div class="answer"><p>β
Punnett square </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> Q 20: Mendel called the things inherited from parents to offspring as factors. Now it is known as β¦β¦β¦ </div>
<div class="answer"> <p>β
Genes </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question">Q 21: Crossing of an organism with dominant phenotype to a recessive individual is called β¦β¦β¦. </div>
<div class="answer"><p>β
Testcross </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> Q 22: Monohybrid test cross ratio is ......... </div>
<div class="answer"> <p>β
1:1 </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question">Q 23: Mendel conducted β¦β¦... to determine F2 genotype. </div>
<div class="answer"><p>β
Test cross </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> Q 24: Test cross is used to find out the β¦β¦β¦β¦β¦ of a character. </div>
<div class="answer"> <p>β
Unknown genotype </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question">Q 25: A cross between two parents differing in 2 pairs of contrasting characters is called </div>
<div class="answer"><p>β
Dihybrid cross </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> Q 26: Genotype of heterozygous round yellow is written as </div>
<div class="answer"> <p>β
RrYy </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question">Q 27: On observing the F2 of dihybrid cross, Mendel found that yellow and green colour segregated in a β¦β¦β¦ ratio. </div>
<div class="answer"><p>β
3:1 </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> Q 28: Dihybrid Phenotypic ratio is </div>
<div class="answer"> <p>β
9:3:3:1 </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question">Q 29: Dihybrid genotypic ratio is </div>
<div class="answer"><p>β
1:2:1:2:4:2:1:2:1 </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> Q 30: According to the First Law (Law of Dominance), characters are controlled by discrete units called β¦β¦β¦β¦ </div>
<div class="answer"> <p>β
Factors </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> Q 31: During gamete formation, the factors (alleles) of a character pair present in parents segregate from each other such that a gamete receives only one of the 2 factors. This law is called ........... </div>
<div class="answer"> <p>β
Law of Segregation (Mendelβs Second Law) </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> Q 32: Which Mendelβs law is based on the results of dihybrid crosses? </div>
<div class="answer"> <p>β
Law of Independent Assortment (Mendelβs Third Law) </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> Q 33: When two pairs of traits are combined in a hybrid, segregation of one pair of characters is independent of the other pair of characters. This law is known as ........... </div>
<div class="answer"> <p>β
Law of Independent Assortment </div>
<button class="answer-button">View Answer</button>
</div>
<p style="font-size: 22px; font-family: Arial; text-align: center; color: #0c8a7d;"> <b> Topic 2: OTHER PATTERNS OF INHERITANCE </b> </p>
<div class="box">
<div class="question"> Q 34: An inheritance in which heterozygous offspring shows intermediate character between two parental characteristics is called </div>
<div class="answer"> <p>β
Incomplete Dominance </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> Q 35: In snapdragon (dog flower or Antirrhinum), cross between homozygous red & white produces pink flowered plant. This is an example for </div>
<div class="answer"> <p>β
Incomplete Dominance </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> Q 36: In β¦β¦β¦β¦β¦, phenotypic & genotypic ratios are same. </div>
<div class="answer"> <p>β
Incomplete Dominance </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> Q 37: In incomplete dominance, phenotypic and genotypic ratios are </div>
<div class="answer"> <p>β
1: 2: 1 </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> Q 38: In heterozygotes, Modified allele will be generally ............ </div>
<div class="answer"> <p>β
Recessive </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> Q 39: β¦β¦β¦β¦β¦β¦. Is the inheritance in which both alleles of a gene are expressed in a hybrid. </div>
<div class="answer"> <p>β
Co-dominance </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> Q 40: A classic example of codominance in genetics is the ............ </div>
<div class="answer"> <p>β
ABO blood group system </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> Q 41: ABO blood groups are controlled by the gene .......... </div>
<div class="answer"> <p>β
I </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> Q 42: Genotypes of A group is either I<sup>A</sup> I<sup>A</sup> or β¦β¦β¦β¦ </div>
<div class="answer"> <p>β
I<sup>A</sup> i </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> Q 43: Genotype of AB group is always </div>
<div class="answer"> <p>β
I<sup>A</sup> I<sup>B</sup> </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> Q 44: ii is the genotype of β¦β¦β¦β¦β¦β¦ </div>
<div class="answer"> <p>β
O group </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> Q 45: In ABO system, β¦β¦β¦β¦. shows codominance </div>
<div class="answer"> <p>β
I<sup>A</sup> I<sup>B</sup> </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> Q 46: When I<sup>A</sup> and I<sup>B</sup> are present together, they both express their own types of sugar antigens on RBC. This is due to ........ </div>
<div class="answer"> <p>β
Co-dominance </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> Q 47: The presence of more than two alleles of a gene to govern same character is called </div>
<div class="answer"> <p>β
Multiple allelism </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> Q 48: For the gene of ABO blood grouping, there are β¦β¦... types of alleles. </div>
<div class="answer"> <p>β
3 </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> Q 49: The inheritance in which some traits are controlled by several genes (multiple genes) is called </div>
<div class="answer"> <p>β
Polygenic inheritance </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> Q 50: Human skin colour, human height etc. are examples of β¦β¦β¦β¦β¦. Inheritance. </div>
<div class="answer"> <p>β
Polygenic </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> Q 51: In a β¦β¦β¦β¦.. trait, the phenotype reflects contribution of each allele, i.e., the effect of each allele is additive. </div>
<div class="answer"> <p>β
Polygenic </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> Q 52: In human, the genotype of darkest skin colour is AABBCC and that of lightest skin colour is </div>
<div class="answer"> <p>β
aabbcc </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> Q 53: A phenomenon in which a single gene exhibits multiple phenotypic expression is called </div>
<div class="answer"> <p>β
Pleiotropy </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> Q 54: In heterozygous condition, starch grain size of pea plant is intermediate sized. So it is an example for β¦β¦β¦. </div>
<div class="answer"> <p>β
Incomplete dominance </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> Q 55: Phenylketonuria causes mental retardation, reduction in hair & skin pigmentation. So it is an example for β¦β¦β¦ </div>
<div class="answer"> <p>β
Pleiotropy </div>
<button class="answer-button">View Answer</button>
</div>
<p style="font-size: 22px; font-family: Arial; text-align: center; color: #0c8a7d;"> <b> Topic 3: CHROMOSOMAL THEORY, LINKAGE, RECOMBINATION </b> </p>
<div class="box">
<div class="question"> Q 56: In 1900, de Vries, Correns and β¦β¦β¦β¦. independently rediscovered Mendelβs results. </div>
<div class="answer"> <p>β
von Tschermak </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> Q 57: Chromosomal Theory of Inheritance (1902) was proposed by ............. </div>
<div class="answer"> <p>β
Walter Sutton & Theodore Boveri </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> Q 58: β¦β¦β¦β¦β¦. united chromosomal segregation with Mendelian principles and called it the chromosomal theory of inheritance. </div>
<div class="answer"> <p>β
Sutton </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> Q 59: β¦β¦β¦β¦β¦β¦. proved chromosomal theory of inheritance using fruit flies (Drosophila melanogaster). </div>
<div class="answer"> <p>β
Thomas Hunt Morgan </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> Q 60: The physical association of genes on a chromosome is called </div>
<div class="answer"> <p>β
Linkage </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> Q 61: The generation of non-parental gene combinations is called </div>
<div class="answer"> <p>β
Recombination </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> Q 62: The terms linkage and recombination were coined by </div>
<div class="answer"> <p>β
Morgan </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> Q 63: Morgan carried out several dihybrid crosses in β¦β¦β¦. to study sex-linked genes. </div>
<div class="answer"> <p>β
<i>Drosophila</i> </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> Q 64: In <i>Drosophila</i>, genes of body colour, eye colour and wing size are located on the β¦β¦β¦.. </div>
<div class="answer"> <p>β
X chromosome </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> Q 65: When two genes are situated on same chromosome, proportion of parental gene combinations will be much higher than the non-parental type. This is due to β¦β¦β¦β¦β¦β¦. </div>
<div class="answer"> <p>β
Linkage </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> Q 66: In <i>Drosophila</i>, genes of white eye & yellow body were very tightly linked and showed only β¦β¦β¦. recombination. </div>
<div class="answer"> <p>β
1.3% </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> Q 67: In <i>Drosophila</i>, genes of white eye & miniature wing were loosely linked and showed β¦β¦β¦β¦ recombination. </div>
<div class="answer"> <p>β
37.2% </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> Q 68: β¦β¦β¦β¦. genes show low recombination. </div>
<div class="answer"> <p>β
Tightly linked </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> Q 69: β¦β¦β¦β¦ used the recombination frequency between gene pairs for measuring the distance between genes and mapped their position on the chromosome. </div>
<div class="answer"> <p>β
Alfred Sturtevant </div>
<button class="answer-button">View Answer</button>
</div>
<p style="font-size: 22px; font-family: Arial; text-align: center; color: #0c8a7d;"> <b> Topic 4: SEX DETERMINATION </b> </p>
<div class="box">
<div class="question"> Q 70: The chromosomes that are involved in sex determination are called </div>
<div class="answer"> <p>β
Sex chromosomes </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> Q 71: The chromosomes other than sex chromosomes are called </div>
<div class="answer"> <p>β
Autosomes </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> Q 72: In 1891, β¦β¦β¦β¦.. studied spermatogenesis in some insects and observed that 50 % of sperm received a nuclear structure after spermatogenesis, and other 50 % sperm did not receive it. </div>
<div class="answer"> <p>β
Henking </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> Q 73: Who discovered X chromosome? </div>
<div class="answer"> <p>β
Henking </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> Q 74: Sex determination mechanism of insects such as grasshopper is β¦β¦β¦β¦β¦. </div>
<div class="answer"> <p>β
XX-XO mechanism </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> Q 75: In which sex determination system, the number of chromosomes in the male and female are not equal? </div>
<div class="answer"> <p>β
XX-XO </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> Q 76: Sex determination mechanism of Human and Drosophila is β¦β¦β¦β¦β¦. </div>
<div class="answer"> <p>β
XX-XY mechanism </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> Q 77: The sex determination mechanism of birds is .......... </div>
<div class="answer"> <p>β
ZZ-ZW </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> Q 78: In birds sex determination system, female is represented as .......... </div>
<div class="answer"> <p>β
ZW </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> Q 79: In which sex determination mechanism, male shows homogamety and female shows heterogamety? </div>
<div class="answer"> <p>β
ZZ-ZW mechanism </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> Q 80: During spermatogenesis, males produce 2 types of gametes: 50 % with X-chromosome and 50 % with β¦β¦β¦β¦ </div>
<div class="answer"> <p>β
Y-chromosome </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> Q 81: In XX-XY system, the β¦β¦β¦. determines whether the offspring male or female. </div>
<div class="answer"> <p>β
Sperm </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> Q 82: Sex determination in β¦β¦β¦β¦. is based on the number of sets of chromosomes an individual receives. </div>
<div class="answer"> <p>β
Honeybee </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> Q 83: In honeybee, an unfertilised egg develops as a male (drone). It is called β¦β¦β¦β¦β¦. </div>
<div class="answer"> <p>β
Parthenogenesis </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> Q 84: In honeybee, females are diploid (32 chromosomes) and males are haploid (16 chromosomes). This is called as β¦β¦β¦. sex determination system. </div>
<div class="answer"> <p>β
Haplodiploid </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> Q 85: In Haplodiploid sex determination system, the males produce sperms by β¦β¦β¦. </div>
<div class="answer"> <p>β
Mitosis </div>
<button class="answer-button">View Answer</button>
</div>
<p style="font-size: 22px; font-family: Arial; text-align: center; color: #0c8a7d;"> <b> Topic 5: MUTATION, PEDIGREE ANALYSIS AND GENETIC DISORDERS </b> </p>
<div class="box">
<div class="question"> Q 86: The alteration of DNA sequences resulting in changes in the genotype and phenotype of an organism is called </div>
<div class="answer"> <p>β
Mutation </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> Q 87: The change (substitution) in a single base pair of a DNA is called β¦β¦β¦β¦β¦ </div>
<div class="answer"> <p>β
Point mutation </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> Q 88: β¦β¦β¦β¦β¦.. is an example for point mutation. </div>
<div class="answer"> <p>β
Sickle cell anaemia </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> Q 89: The deletion or insertion of base pairs resulting in the shifting of DNA sequences is known as </div>
<div class="answer"> <p>β
Frame-shift mutation </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> Q 90: The agents which induce mutation are called </div>
<div class="answer"> <p>β
Mutagens </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> Q 91: An analysis of genetic history of traits in several generations of a family is called </div>
<div class="answer"> <p>β
Pedigree analysis </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> Q 92: The representation or chart showing family history is called </div>
<div class="answer"> <p>β
Family tree (pedigree) </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> Q 93: In pedigree analysis, affected female is represented as </div>
<div class="answer"> <p>β
⬀ </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> Q 94: The symbol π² is used to represent β¦β¦β¦β¦. </div>
<div class="answer"> <p>β
Male </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> Q 95: In pedigree analysis, the symbol used for sex unspecified is </div>
<div class="answer"> <p>β
β </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> Q 96: What is the symbol used in pedigree that shows consanguineous mating? </div>
<div class="answer"> <p>β
π²=β― </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> Q 97: The disorders caused by alteration or mutation in the single gene are called </div>
<div class="answer"> <p>β
Mendelian Disorders </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> Q 98: Which of the following is not a Mendelian disorder? <p> Sickle-cell anaemia, Downβs syndrome, Thalassemia, Cystic fibrosis. </div>
<div class="answer"> <p>β
Downβs syndrome </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> Q 99: The pattern of inheritance of Mendelian disorders can be traced in a family by β¦β¦β¦β¦ </div>
<div class="answer"> <p>β
Pedigree analysis </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> Q 100: An example for the disease caused due to Autosomal dominant allele is </div>
<div class="answer"> <p>β
Myotonic dystrophy </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> Q 101: A sex linked (X-linked) recessive disease, in which a protein involved in the blood clotting is affected is called β¦β¦β¦β¦β¦.. </div>
<div class="answer"> <p>β
Haemophilia </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> Q 102: In females, haemophilia is very rare because it happens only when mother is at least β¦β¦β¦. and father haemophilic. </div>
<div class="answer"> <p>β
Carrier </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> Q 103: Queen Victoria was a carrier of β¦β¦β¦β¦β¦. </div>
<div class="answer"> <p>β
Hemophilia </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> Q 104: A sex-linked recessive disorder due to defect in either red or green cone of eye is called </div>
<div class="answer"> <p>β
Colour blindness </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> Q 105: Colour blindness results in failure to discriminate between .......... </div>
<div class="answer"> <p>β
Red and green colour </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> Q 106: Colour blindness results occurs in 8% of males and β¦β¦β¦. of females. </div>
<div class="answer"> <p>β
0.4% </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> Q 107: The son of a woman heterozygous for colour blindness has a β¦β¦β¦β¦ chance of being colour blind. </div>
<div class="answer"> <p>β
50% </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> Q 108: Sickle cell anaemia occurs in both sexes as it is β¦β¦β¦β¦ recessive disease. </div>
<div class="answer"> <p>β
Autosome-linked </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> Q 109: Sickle cell anaemia is controlled by a pair of alleles such as ......... </div>
<div class="answer"> <p>β
Hb<sup>A</sup> & Hb<sup>S</sup> </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> Q 110: The genotype of sickle cell anaemic person is </div>
<div class="answer"> <p>β
Hb<sup>S</sup>Hb<sup>S</sup> </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> Q 111: Sickle cell anaemia is caused by the substitution of Glutamic acid by β¦β¦β¦ at the sixth position of the Ξ²-globin chain of the haemoglobin (Hb). </div>
<div class="answer"> <p>β
Valine </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> Q 112: Sickle cell anaemia is due to the single base substitution at the sixth codon of the Ξ²-globin gene from GAG to β¦β¦β¦β¦ </div>
<div class="answer"> <p>β
GUG </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> Q 113: In Sickle cell anaemia, shape of the β¦β¦β¦ changes from biconcave disc to elongated sickle like structure under low oxygen tension. </div>
<div class="answer"> <p>β
RBC </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> Q 114: β¦β¦β¦β¦β¦ is an autosomal recessive disease resulting from an inborn error of metabolism. </div>
<div class="answer"> <p>β
Phenylketonuria </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> Q 115: Phenylketonuria is due to mutation of a gene that codes for the enzyme β¦β¦β¦β¦β¦β¦ responsible for the conversion of an amino acid phenylalanine into tyrosine. </div>
<div class="answer"> <p>β
<i>Phenylalanine hydroxylase</i> </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> Q 116: In a patient with Phenylketonuria, phenylalanine accumulates and converts into β¦β¦β¦β¦β¦ and other derivatives. </div>
<div class="answer"> <p>β
Phenyl pyruvic acid </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> Q 117: An autosome-linked recessive blood disease that results in reduced synthesis of Ξ± or Ξ² globin chains of haemoglobin is called β¦β¦β¦β¦. </div>
<div class="answer"> <p>β
Thalassemia </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> Q 118: In Ξ± Thalassemia, production of Ξ± globin chain is affected due to the mutation or deletion of two closely linked genes β¦β¦β¦β¦. on chromosome 16. </div>
<div class="answer"> <p>β
HBA1 & HBA2 </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> Q 119: In Ξ² Thalassemia, production of Ξ² globin chain is affected due to the mutation of a single gene HBB on β¦β¦β¦β¦. </div>
<div class="answer"> <p>β
Chromosome 11 </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> Q 120: Thalassemia is a quantitative problem of haemoglobin whereas β¦β¦β¦β¦. is a qualitative problem. </div>
<div class="answer"> <p>β
Sickle-cell anaemia </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> Q 121: The gain or loss of chromosomes due to failure of segregation of chromatids during cell division is known as ......... </div>
<div class="answer"> <p>β
Aneuploidy </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> Q 122: An increase in a whole set of chromosomes due to failure of cytokinesis after telophase stage of cell division is known as </div>
<div class="answer"> <p>β
Polyploidy (Euploidy) </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> Q 123: Which of the following is not a chromosomal disorder? <p> Myotonic dystrophy, Downβs syndrome, Turnerβs syndrome, Klinefelterβs Syndrome. </div>
<div class="answer"> <p>β
Myotonic dystrophy </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> Q 124: The presence of an additional copy of chromosome number 21 (trisomy of 21) is called </div>
<div class="answer"> <p>β
Downβs syndrome </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> Q 125: Downβs syndrome was first described by β¦β¦β¦. </div>
<div class="answer"> <p>β
Langdon Down </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> Q 126: Karyotype of Downβs syndrome is ........ </div>
<div class="answer"> <p>β
45 A + XX or 45 A + XY </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> Q 127: A child with short stature, small round head, broad flat face, furrowed big tongue and partially open mouth may have .......... </div>
<div class="answer"> <p>β
Downβs syndrome </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> Q 128: The presence of an additional copy of X-chromosome in male (trisomy) is called </div>
<div class="answer"> <p>β
Klinefelterβs Syndrome </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> Q 129: Karyotype of Klinefelterβs Syndrome is </div>
<div class="answer"> <p>β
44 A + XXY </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> Q 130: Feminine development such as Gynaecomastia, tall stature and sterility are the features of </div>
<div class="answer"> <p>β
Klinefelterβs Syndrome </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> Q 131: The absence of one X chromosome in female (monosomy) is known as </div>
<div class="answer"> <p>β
Turnerβs syndrome </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> Q 132: Karyotype of Turnerβs syndrome is ........ </div>
<div class="answer"> <p>β
44 A + XO </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> Q 133: Sterility, rudiment ovaries, short stature and lack of other secondary sexual characters are the features of ......... </div>
<div class="answer"> <p>β
Turnerβs syndrome </div>
<button class="answer-button">View Answer</button>
</div>
<script>
// Get all the answer buttons
const answerButtons = document.querySelectorAll('.answer-button');
// Add a click event listener to each answer button
answerButtons.forEach(button => {
button.addEventListener('click', () => {
// Get the answer section for this button
const answerSection = button.previousElementSibling;
// Toggle the answer section's visibility
answerSection.classList.toggle('visible');
// Change the button text to "Hide Answer" or "View Answer"
if (answerSection.classList.contains('visible')) {
button.textContent = 'Hide Answer';
button.classList.add('hide-answer');
} else {
button.textContent = 'View Answer';
button.classList.remove('hide-answer');
}
});
});
</script>
<html>
<head>
<style>
.special-paragraph {
margin-bottom: -10px; /* Adjust this value to reduce the space */
color: #333333;
font-family: Arial, sans-serif;
font-size: 23px;
font-weight: bold;
line-height: 1.5;
padding: 7px;
text-align: center;
border-radius: 10px;
}
.green-bg {
background-color: #ddffd9; /* Green background */
}
.blue-bg {
background-color: #b0eaff; /* Blue background */
}
</style>
</head>
<body>
<p class="special-paragraph green-bg">
<a href="https://www.bankofbiology.com/2020/08/neet-entrance-basic-level-t-10-online.html" style="color: green;"> π Do an Online Test </a>
</p>
<p class="special-paragraph blue-bg">
<a href="https://www.bankofbiology.com/p/question-bank.html" style="color: blue;"> π Questions from other chapters </a>
</p>
</body>
</html>
<div class="blogger-post-footer"><p> Β© copyright 2024 β All rights reserved </p>
<a href=βhttps://www.bankofbiology.comβ>bankofbiology.com</a></div>Abu Raniyahttp://www.blogger.com/profile/14189496606355139812noreply@blogger.com0tag:blogger.com,1999:blog-6823671394482492613.post-31391382778435287502023-12-15T15:11:00.018+05:302023-12-29T21:42:34.766+05:30Reproductive Health | Class 12 | One-Word Answer Type Questions | Topic - wise<!DOCTYPE html>
<html>
<head>
<title>Example Webpage</title>
<style>
body {
user-select: none; /* Prevent selection of text */
-moz-user-select: none; /* Firefox */
-webkit-user-select: none; /* Safari and Chrome */
-ms-user-select: none; /* Internet Explorer/Edge */
}
h1 {
user-select: text; /* Allow selection of title */
}
</style>
</head>
<p style="font-size: 22px; font-family: Arial; text-align: center; color: #0c8a7d;"> <b>Topic 1: INTRODUCTION </b> </p>
<style>
/* Customize the box style */
.box {
background-color: #f3ffe0;
border: 1px solid #93b163;
border-radius: 5px;
padding: 10px;
margin-bottom: 10px;
margin-right: -7px;
margin-left: -7px;
}
/* Customize the question style */
.question {
font-size: 17px;
font-weight: bold;
color: #3d454a;
font-family: Roboto;
margin-bottom: 10px;
}
/* Customize the answer style */
.answer {
font-size: 18px;
font-weight: normal;
font-family: Roboto;
margin-bottom: 10px;
}
/* Hide the answer by default */
.answer {
display: none;
}
/* Customize the view/hide answer button */
.answer-button {
background-color: #4CAF50;
border: none;
border-radius: 5px;
color: white;
padding: 8px 16px;
text-align: center;
text-decoration: none;
display: inline-block;
font-size: 18px;
margin-bottom: 1px;
cursor: pointer;
}
/* Style the button differently when it changes to "Hide Answer" */
.answer-button.hide-answer {
background-color: #f44336;
}
/* Show the answer when the visible class is added */
.answer.visible {
display: block;
</style>
<div class="box">
<div class="question">Q 1: The definition of Reproductive health as a total well-being in all aspects of reproduction is given by </div>
<div class="answer"> <p>β
World Health Organisation (WHO) </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question">Q 2: In 1951, India initiated reproductive health programmes called </div>
<div class="answer"> <p>β
Family Planning </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question">Q 3: Wider reproduction-related areas are in operation under </div>
<div class="answer"> <p>β
Reproductive & Child Health Care (RCH) programmes </div>
<button class="answer-button">View Answer</button>
</div>
<p style="font-size: 22px; font-family: Arial; text-align: center; color: #0c8a7d;"> <b>Topic 2: POPULATION STABILIZATION & BIRTH CONTROL </b> </p>
<div class="box">
<div class="question"> Q 4: According to the 2011 census report, our population growth rate was less than </div>
<div class="answer"> <p>β
2% </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question">Q 5: MMR stands for </div>
<div class="answer"> <p>β
Maternal Mortality Rate </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> Q 6: IMR stands for </div>
<div class="answer"> <p>β
Infant Mortality Rate </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question">Q 7: Odd one out: <p>Periodic abstinence, Coitus interruptus, Lippes loop, Lactational amenorrhea. </div>
<div class="answer"> <p>β
Lippes loop </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> Q 8: A natural contraceptive method in which coitus is avoided from day 10 to 17 (fertile period) of menstrual cycle to prevent conception is called </div>
<div class="answer"> <p>β
Periodic abstinence </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question">Q 9: A natural contraceptive method of withdrawal of penis from the vagina just before ejaculation to avoid insemination is </div>
<div class="answer"> <p>β
Coitus interruptus (withdrawal) </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> Q 10: The absence of menstrual cycle and ovulation due to intense lactation after parturition is called </div>
<div class="answer"> <p>β
Lactational amenorrhea </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question">Q 11: Lactational amenorrhea is effective up to β¦β¦β¦ following parturition. </div>
<div class="answer"> <p>β
6 months </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> Q 12: β¦β¦β¦β¦ are a type of contraceptive method that prevent physical meeting of sperm & ovum. </div>
<div class="answer"> <p>β
Barriers </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question">Q 13: A barrier method made of rubber or latex and can be used by male to cover the penis is </div>
<div class="answer"> <p>β
Condoms </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> Q 14: β¦β¦β¦. is a popular brand of condom for the male. </div>
<div class="answer"> <p>β
Nirodh </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question">Q 15: Condoms for female is used to cover the vagina and β¦β¦β¦β¦β¦.. </div>
<div class="answer"> <p>β
Cervix </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> Q 16: Use of condoms has increased in recent years due to its additional benefit of protecting the user from </div>
<div class="answer"> <p>β
STIs and AIDS </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question">Q 17: Which of the following is not come under barrier? <p>Multiload 375, Diaphragms, Cervical caps, Vaults </div>
<div class="answer"> <p>β
Multiload 375 </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> Q 18: β¦β¦β¦.. creams, jellies & foams are used along with the barriers to increase contraceptive efficiency. </div>
<div class="answer"> <p>β
Spermicidal </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question">Q 19: The contraceptive devices which are inserted by doctors or nurses in the uterus through vagina is called </div>
<div class="answer"> <p>β
Intra Uterine Devices (IUDs) </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> Q 20: β¦β¦β¦β¦β¦ are ideal method to delay pregnancy or space children. </div>
<div class="answer"> <p>β
IUDs </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question">Q 21: An example for non-medicated IUDs is </div>
<div class="answer"> <p>β
Lippes loop </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> Q 22: CuT, Cu7 and β¦β¦β¦β¦β¦... are copper releasing IUDs that can release Cu ions to suppress motility and fertilising capacity of sperms. </div>
<div class="answer"> <p>β
Multiload 375 </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question">Q 23: Progestasert, LNG-20 are two examples for </div>
<div class="answer"> <p>β
Hormone releasing IUDs </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> Q 24: Which type of IUDs make the uterus unsuitable for implantation and the cervix hostile to the sperms? </div>
<div class="answer"> <p>β
Hormone releasing IUDs </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question">Q 25: Oral contraceptive of β¦β¦β¦β¦β¦β¦ is a contraceptive method used by the females. </div>
<div class="answer"> <p>β
Progestogens or progestogenβestrogen combinations </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> Q 26: β¦β¦β¦.. is the new oral contraceptive for the females that contains a non-steroidal preparation. </div>
<div class="answer"> <p>β
Saheli </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question">Q 27: Saheli is developed by β¦β¦β¦β¦. </div>
<div class="answer"> <p>β
Central Drug Research Institute (CDRI, Lucknow) </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> Q 28: Which oral contraceptive is known as βonce a weekβ pill? </div>
<div class="answer"> <p>β
Saheli </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question">Q 29: β¦β¦β¦β¦β¦. combination are used by females as injections or implants under skin. </div>
<div class="answer"> <p>β
Progestogens or Progestogens-oestrogen </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> Q 30: Progestogens or progestogen-oestrogen combinations & IUDs are used as β¦β¦β¦β¦β¦β¦ within 72 hours of coitus. </div>
<div class="answer"> <p>β
Emergency contraceptives </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> Q 31: Which contraceptive method is very effective but have very poor reversibility? </div>
<div class="answer"> <p>β
Surgical methods (sterilization) </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> Q 32: Sterilization procedure in males is called </div>
<div class="answer"> <p>β
Vasectomy </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> Q 33: In vasectomy, a small part of the β¦β¦β¦β¦. is removed or tied up through a small incision on the scrotum. </div>
<div class="answer"> <p>β
Vas deferens </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> Q 34: Sterilization procedure in females is called </div>
<div class="answer"> <p>β
Tubectomy </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> Q 35: In Tubectomy, a small part of the β¦β¦β¦β¦ is removed or tied up through a small incision in abdomen or through vagina. </div>
<div class="answer"> <p>β
Fallopian tube </div>
<button class="answer-button">View Answer</button>
</div>
<p style="font-size: 22px; font-family: Arial; text-align: center; color: #0c8a7d;"> <b>Topic 3: MEDICAL TERMINATION OF PREGNANCY (MTP) </b> </p>
<div class="box">
<div class="question"> Q 36: Intentional or voluntary termination of pregnancy before full term is called .......... </div>
<div class="answer"> <p>β
MTP or induced abortion </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> Q 37: MTP stands for </div>
<div class="answer"> <p>β
Medical Termination of Pregnancy </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> Q 38: Government of India legalised MTP in 1971 with some strict conditions to check illegal ........... </div>
<div class="answer"> <p>β
Female foeticides </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> Q 39: MTPs are safe during the ......... </div>
<div class="answer"> <p>β
First trimester </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> Q 40: Name the test which is misused for foetal sex determination. </div>
<div class="answer"> <p>β
Amniocentesis </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> Q 41: β¦β¦β¦. is a test in which some amniotic fluid of the foetus is taken to analyse the foetal cells & dissolved substances for finding the presence of genetic disorders, survivability of the foetus etc. </div>
<div class="answer"> <p>β
Amniocentesis </div>
<button class="answer-button">View Answer</button>
</div>
<p style="font-size: 22px; font-family: Arial; text-align: center; color: #0c8a7d;"> <b>Topic 4: SEXUALLY TRANSMITTED DISEASES (STDs) </b> </p>
<div class="box">
<div class="question"> Q 42: Full form of STD is </div>
<div class="answer"> <p>β
Sexually Transmitted Diseases </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> Q 43: STDs are also known as </div>
<div class="answer"> <p>β
Venereal diseases (VD) or Reproductive tract infections (RTI) </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> Q 44: Which of the following is not STD? <p>Gonorrhoea, Typhoid, syphilis, genital herpes, chlamydiasis. </div>
<div class="answer"> <p>β
Typhoid </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> Q 45: Which disease is transmitted through the same means of transmission as HIV? </div>
<div class="answer"> <p>β
Hepatitis-B </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> Q 46: Except hepatitis-B, genital herpes & β¦β¦β¦. other diseases are completely curable if detected early and treated properly. </div>
<div class="answer"> <p>β
HIV </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> Q 47: PID stands for </div>
<div class="answer"> <p>β
Pelvic Inflammatory Diseases </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> Q 48: STDs are very high among persons in the age group of </div>
<div class="answer"> <p>β
15-24 years </div>
<button class="answer-button">View Answer</button>
</div>
<p style="font-size: 22px; font-family: Arial; text-align: center; color: #0c8a7d;"> <b>Topic 5: INFERTILITY & ASSISTED REPRODUCTIVE TECHNOLOGIES (ART) </b> </p>
<div class="box">
<div class="question"> Q 49: The inability to conceive or produce children even after 2 years of unprotected sexual cohabitation is called </div>
<div class="answer"> <p>β
Infertility </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> Q 50: The technologies used to correct the infertility problems are called </div>
<div class="answer"> <p>β
Assisted Reproductive Technologies (ART) </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> Q 51: Ova from the wife/donor and sperms from the husband/donor are collected and are induced to form zygote under simulated conditions in the laboratory. This method is called </div>
<div class="answer"> <p>β
<i>In vitro</i> fertilisation (IVF) </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> Q 52: IVF is popularly known as </div>
<div class="answer"> <p>β
Test tube baby programme </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> Q 53: ZIFT and β¦β¦β¦. are two types of Embryo Transfer. </div>
<div class="answer"> <p>β
IUT </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> Q 54: Transfer of zygote or early embryo (with up to 8 blastomeres) into fallopian tube is called ......... </div>
<div class="answer"> <p>β
Zygote Intra Fallopian Transfer (ZIFT) </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> Q 55: Transfer of embryo with more than 8 blastomeres into the uterus is called .......... </div>
<div class="answer"> <p>β
Intra Uterine Transfer (IUT) </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> Q 56: Embryo formed by β¦β¦β¦β¦. (fertilisation within the female) is also used for embryo transfer to assist the females who cannot conceive. </div>
<div class="answer"> <p>β
<i>in vivo</i> fertilisation </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> Q 57: β¦β¦β¦β¦.. is a type ART in which an ovum from a donor is transferred into the fallopian tube of another female who cannot produce ovum, but can provide suitable environment for fertilization & development. </div>
<div class="answer"> <p>β
Gamete Intra Fallopian Transfer (GIFT) </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> Q 58: A laboratory procedure in which a sperm from male partner is injected directly into an egg from female partner is known as </div>
<div class="answer"> <p>β
Intra cytoplasmic sperm injection (ICSI) </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> Q 59: The technique in which semen collected from husband or a donor is artificially introduced into the vagina or the uterus of the female is called </div>
<div class="answer"> <p>β
Artificial insemination (AI) </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> Q 60: Artificial insemination into the uterus is known as </div>
<div class="answer"> <p>β
Intra-uterine insemination (IUI) </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> Q 61: Name the technique useful for the male partner having inability to inseminate female or low sperm counts. </div>
<div class="answer"> <p>β
Artificial insemination (AI) </div>
<button class="answer-button">View Answer</button>
</div>
<script>
// Get all the answer buttons
const answerButtons = document.querySelectorAll('.answer-button');
// Add a click event listener to each answer button
answerButtons.forEach(button => {
button.addEventListener('click', () => {
// Get the answer section for this button
const answerSection = button.previousElementSibling;
// Toggle the answer section's visibility
answerSection.classList.toggle('visible');
// Change the button text to "Hide Answer" or "View Answer"
if (answerSection.classList.contains('visible')) {
button.textContent = 'Hide Answer';
button.classList.add('hide-answer');
} else {
button.textContent = 'View Answer';
button.classList.remove('hide-answer');
}
});
});
</script>
<html>
<head>
<style>
.special-paragraph {
margin-bottom: -10px; /* Adjust this value to reduce the space */
color: #333333;
font-family: Arial, sans-serif;
font-size: 23px;
font-weight: bold;
line-height: 1.5;
padding: 7px;
text-align: center;
border-radius: 10px;
}
.green-bg {
background-color: #ddffd9; /* Green background */
}
.blue-bg {
background-color: #b0eaff; /* Blue background */
}
</style>
</head>
<body>
<p class="special-paragraph green-bg">
<a href="https://www.bankofbiology.com/2020/08/neet-entrance-basic-level-t-10-online.html" style="color: green;"> π Do an Online Test </a>
</p>
<p class="special-paragraph blue-bg">
<a href="https://www.bankofbiology.com/p/question-bank.html" style="color: blue;"> π Questions from other chapters </a>
</p>
</body>
</html>
<div class="blogger-post-footer"><p> Β© copyright 2024 β All rights reserved </p>
<a href=βhttps://www.bankofbiology.comβ>bankofbiology.com</a></div>Abu Raniyahttp://www.blogger.com/profile/14189496606355139812noreply@blogger.com0tag:blogger.com,1999:blog-6823671394482492613.post-63959255794448072722023-12-13T15:42:00.278+05:302023-12-29T21:43:00.579+05:30Human Reproduction | Class 12 | One-Word Answer Type Questions | Topic - wise<!DOCTYPE html>
<html>
<head>
<title>Example Webpage</title>
<style>
body {
user-select: none; /* Prevent selection of text */
-moz-user-select: none; /* Firefox */
-webkit-user-select: none; /* Safari and Chrome */
-ms-user-select: none; /* Internet Explorer/Edge */
}
h1 {
user-select: text; /* Allow selection of title */
}
</style>
</head>
<p style="font-size: 22px; font-family: Arial; text-align: center; color: #0c8a7d;"><strong>Topic 1: MALE REPRODUCTIVE SYSTEM</strong></p>
<style>
/* Customize the box style */
.box {
background-color: #f2feff;
border: 1px solid #217f71;
border-radius: 5px;
padding: 10px;
margin-bottom: 10px;
margin-right: -7px;
margin-left: -7px;
}
/* Customize the question style */
.question {
font-size: 17px;
font-weight: bold;
color: #3d454a;
font-family: Roboto;
margin-bottom: 10px;
}
/* Customize the answer style */
.answer {
font-size: 18px;
font-weight: normal;
font-family: Roboto;
margin-bottom: 10px;
}
/* Hide the answer by default */
.answer {
display: none;
}
/* Customize the view/hide answer button */
.answer-button {
background-color: #4CAF50;
border: none;
border-radius: 5px;
color: white;
padding: 8px 16px;
text-align: center;
text-decoration: none;
display: inline-block;
font-size: 18px;
margin-bottom: 1px;
cursor: pointer;
}
/* Style the button differently when it changes to "Hide Answer" */
.answer-button.hide-answer {
background-color: #f44336;
}
/* Show the answer when the visible class is added */
.answer.visible {
display: block;
}
.table-text {
display: grid;
grid-template-columns: 50% 50%;
grid-gap: none;
margin-top: 5px;
border-collapse: collapse;
}
.table-text-2 {
display: grid;
grid-template-columns: 33.33% 33.33% 33.33%;
grid-gap: none;
margin-top: 5px;
border-collapse: collapse;
}
.table-text-header,
.table-text-cell {
padding: 5px;
border: 1px solid black;
text-align: left;
}
.table-text-header {
font-weight: bold;
text-align: center;
}
.no-break {
white-space: nowrap;
}
.tab {
text-indent: 40px; /* Adjust the value as per your preference */
}
</style>
<div class="box">
<div class="question">Q 1: Name the male primary sex organ. </div>
<div class="answer"><p>β
Testes </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question">Q 2: The hormone produced by testis is called β¦β¦β¦ </div>
<div class="answer"><p>β
Testosterone (androgen) </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question">Q 3: Testes are situated outside the abdominal cavity within a pouch called β¦β¦β¦. </div>
<div class="answer"><p>β
Scrotum </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> Q 4: Each testis has about β¦β¦β¦ testicular lobules. </div>
<div class="answer"> <p>β
250 </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> Q 5: The functional unit of testis is called </div>
<div class="answer"> <p>β
Seminiferous tubule </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> Q 6: The cells present inside the seminiferous tubules and give nutrition to the germ cells are called </div>
<div class="answer"> <p>β
Sertoli cells </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> Q 7: The cells present at the interstitial spaces of seminiferous tubules and produce of androgen are called </div>
<div class="answer"> <p>β
Leydig cells (Interstitial cells) </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> Q 8: Male accessory glands include rete testis, vasa efferentia, epididymis and </div>
<div class="answer"> <p>β
Vas deferens </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> Q 9: The region of accessory glands where sperms are temporarily stored is called </div>
<div class="answer"> <p>β
Epididymis </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> Q 10: The irregular cavities that conduct sperms from seminiferous tubules are called </div>
<div class="answer"> <p>β
Rete testis </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> Q 11: Male Accessory glands include a prostate gland, a pair of seminal vesicles and a pair of ........... </div>
<div class="answer"> <p>β
Cowperβs glands (bulbo-urethral glands) </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> Q 12: Collective secretion of male Accessory glands which is rich in fructose, calcium and enzymes is called </div>
<div class="answer"> <p>β
Seminal plasma </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> Q 13: Seminal plasma and sperms together constitute </div>
<div class="answer"> <p>β
Semen </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> Q 14: Secretions of β¦β¦β¦β¦. lubricate the penis. </div>
<div class="answer"> <p>β
Cowperβs glands </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> Q 15: Name the male external genitalia that facilitates insemination. </div>
<div class="answer"> <p>β
Penis </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> Q 16: The enlarged end of the penis is called </div>
<div class="answer"> <p>β
Glans penis </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> Q 17: Glans penis is covered by loose fold of skin called </div>
<div class="answer"> <p>β
Foreskin </div>
<button class="answer-button">View Answer</button>
</div>
<p style="font-size: 22px; font-family: Arial; text-align: center; color: #0c8a7d;"><strong>Topic 2: FEMALE REPRODUCTIVE SYSTEM </strong></p>
<div class="box">
<div class="question"> Q 18: Female reproductive system is located in </div>
<div class="answer"> <p>β
Pelvic region </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> Q 19: Female primary sex organ which produces ova (female gamete) is called </div>
<div class="answer"> <p>β
Ovaries </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> Q 20: The steroid hormones secreted by ovary are estrogen and </div>
<div class="answer"> <p>β
Progesterone </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> Q 21: Each ovary is covered by a thin epithelium which encloses the β¦β¦β¦β¦ </div>
<div class="answer"> <p>β
Ovarian stroma </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> Q 22: Ovarian cortex contains groups of cells called </div>
<div class="answer"> <p>β
Ovarian follicles </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> Q 23: Each ovarian follicle carries a centrally placed </div>
<div class="answer"> <p>β
Ovum </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> Q 24: Female accessory ducts include two oviducts, a uterus and </div>
<div class="answer"> <p>β
Vagina </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> Q 25: Infundibulum, ampulla and isthmus are the regions of </div>
<div class="answer"> <p>β
Oviducts (Fallopian tubes) </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> Q 26: In fallopian tube, there is a funnel-shaped opening called Infundibulum with many finger-like β¦β¦β¦β¦β¦. </div>
<div class="answer"> <p>β
Fimbriae </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question">Q 27: The inverted pear-shaped part of female reproductive system supported by ligaments is called </div>
<div class="answer"><p>β
Uterus (womb) </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> Q 28: Cervical canal and vagina forms </div>
<div class="answer"> <p>β
Birth canal </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question">Q 29: The uterine wall has 3 layers such as outer perimetrium, middle myometrium and inner β¦β¦β¦.. </div>
<div class="answer"><p>β
Endometrium </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> Q 30: The layer of uterus made up smooth muscle is called </div>
<div class="answer"> <p>β
Myometrium </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> Q 31: Which layer of uterus is glandular and vascular? </div>
<div class="answer"> <p>β
Endometrium </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> Q 32: β¦β¦β¦..... opens to exterior between urethra & anus. </div>
<div class="answer"> <p>β
Vagina </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> Q 33: In female external genitalia (Vulva), there is a cushion of fatty tissue covered by pubic hair. It is called </div>
<div class="answer"> <p>β
Mons pubis </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> Q 34: Large, fleshy, fatty and hairy outer folds that surrounds vaginal opening is called </div>
<div class="answer"> <p>β
Labia majora </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> Q 35: Small, thin and hairless inner folds of vagina is called </div>
<div class="answer"> <p>β
Labia minora </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> Q 36: Name the membrane which partially covers the vaginal opening. </div>
<div class="answer"> <p>β
Hymen </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> Q 37: Which part is often torn during the first coitus, or sudden fall or jolt, insertion of vaginal tampon; active participation in sports etc.? </div>
<div class="answer"> <p>β
Hymen </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> Q 38: A highly sensitive organ in female lying just in front of the urethral opening is β¦β¦β¦. </div>
<div class="answer"> <p>β
Clitoris </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> Q 39: Glandular tissue of each mammary glands (breast) has 15-20 β¦β¦β¦β¦.. </div>
<div class="answer"> <p>β
Mammary lobes </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> Q 40: Name the clusters of cells in mammary glands that secrete milk. </div>
<div class="answer"> <p>β
Mammary alveoli </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> Q 41: The mammary alveoli open into </div>
<div class="answer"> <p>β
Mammary tubules. </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> Q 42: The mammary tubules of each lobe join to form a </div>
<div class="answer"> <p>β
Mammary duct. </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> Q 43: Several mammary ducts join to form a wider β¦β¦β¦β¦. </div>
<div class="answer"> <p>β
Mammary ampulla. </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> Q 44: Mammary ampulla is connected to β¦β¦β¦β¦β¦ through which milk is sucked out. </div>
<div class="answer"> <p>β
Lactiferous duct </div>
<button class="answer-button">View Answer</button>
</div>
<p style="font-size: 22px; font-family: Arial; text-align: center; color: #0c8a7d;"><strong>Topic 3: GAMETOGENESIS </strong></p>
<div class="box">
<div class="question"> Q 45: The formation of gametes in the gonads is called </div>
<div class="answer"> <p>β
Gametogenesis </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> Q 46: The formation of sperms (spermatozoa) from Sperm mother cells (Spermatogonia) in the seminiferous tubules of testis is called </div>
<div class="answer"> <p>β
Spermatogenesis </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> Q 47: During spermatogenesis, the spermatogonia multiply by mitotic division to give </div>
<div class="answer"> <p>β
Primary spermatocytes </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> Q 48: A primary spermatocyte divides meiotically into two equal, haploid cells called </div>
<div class="answer"> <p>β
Secondary spermatocytes </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> Q 49: The secondary spermatocytes undergo second meiotic division to produce four equal, haploid β¦β¦β¦ </div>
<div class="answer"> <p>β
Spermatids </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> Q 50: The spermatids are transformed into spermatozoa (sperms). It is called </div>
<div class="answer"> <p>β
Spermiogenesis </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> Q 51: After spermiogenesis, sperm heads are embedded in Sertoli cells to get nourishment. Then the matured sperms are released from the seminiferous tubules. It is called </div>
<div class="answer"> <p>β
Spermiation </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> Q 52: Number of sperms produced from one primary spermatocyte is </div>
<div class="answer"> <p>β
4 </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> Q 53: GnRH from Hypothalamus stimulates the anterior pituitary gland to secrete 2 gonadotropins called Luteinizing hormone (LH) and </div>
<div class="answer"> <p>β
Follicle stimulating hormone (FSH) </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> Q 54: LH acts on the β¦β¦β¦β¦. and stimulates secretion of androgens. </div>
<div class="answer"> <p>β
Leydig cells </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> Q 55: FSH acts on the β¦β¦β¦β¦. and stimulates secretion of some factors for spermiogenesis.</div>
<div class="answer"> <p>β
Sertoli cells </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> Q 56: The oval shaped Head of a sperm is formed of nucleus and β¦β¦β¦β¦.. </div>
<div class="answer"> <p>β
Acrosome </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> Q 57: Acrosome is formed from </div>
<div class="answer"> <p>β
Golgi complex </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> Q 58: In a sperm, β¦β¦β¦β¦.. is composed of axial filament surrounded by mitochondria & cytoplasm. </div>
<div class="answer"> <p>β
Middle piece </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> Q 59: β¦β¦β¦β¦β¦. produce energy for the sperm motility. </div>
<div class="answer"> <p>β
Mitochondria </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> Q 60: Man ejaculates β¦β¦β¦. sperms during a coitus. </div>
<div class="answer"> <p>β
200-300 million </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> Q 61: For normal fertility, at least β¦β¦β¦ sperms must have normal shape and size. </div>
<div class="answer"> <p>β
60% </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> Q 62: The process of formation and maturation of ovum is called </div>
<div class="answer"> <p>β
Oogenesis </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> Q 63: Oogenesis takes place in β¦β¦β¦β¦β¦ </div>
<div class="answer"> <p>β
Ovarian follicles </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> Q 64: The initial steps of oogenesis start at β¦β¦β¦..</div>
<div class="answer"> <p>β
Embryonic stage </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> Q 65: Oogonia multiply to form </div>
<div class="answer"> <p>β
Primary oocytes </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> Q 66: Primary oocytes enter β¦β¦β¦β¦β¦.. of the meiosis and get temporarily arrested at that stage. </div>
<div class="answer"> <p>β
Prophase-I </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> Q 67: Each primary oocyte gets surrounded by a layer of granulosa cells to form </div>
<div class="answer"> <p>β
Primary follicle </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> Q 68: At puberty, only β¦β¦β¦β¦.. primary follicles are left in each ovary. </div>
<div class="answer"> <p>β
60,000 to 80,000 </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> Q 69: Primary follicles get surrounded by more layers of granulosa cells and a new theca to form </div>
<div class="answer"> <p>β
Secondary follicles </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> Q 70: The secondary follicles transform into a tertiary follicle. It has a fluid filled cavity called </div>
<div class="answer"> <p>β
Antrum </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> Q 71: The theca layer secondary follicle forms an inner theca interna and an outer β¦β¦β¦β¦. </div>
<div class="answer"> <p>β
Theca externa </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> Q 72: The primary oocyte in tertiary follicle grows and undergoes first unequal meiotic division to form a large haploid secondary oocyte and a small β¦β¦β¦β¦β¦β¦ </div>
<div class="answer"> <p>β
Polar body </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> Q 73: Meiotic division of the primary oocyte occurs prior to </div>
<div class="answer"> <p>β
Ovulation </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> Q 74: The tertiary follicle changes into the mature follicle called </div>
<div class="answer"> <p>β
Graafian follicle </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> Q 75: The final step of oogenesis in which secondary oocyte undergoes meiosis II to form mature ovum (ootid) and second polar body occurs after </div>
<div class="answer"> <p>β
Fertilization </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> Q 76: Graafian follicle ruptures to release the secondary oocyte (ovum) from the ovary. This is called </div>
<div class="answer"> <p>β
Ovulation </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> Q 77: The membrane which is outer to the plasma membrane of ovum is called </div>
<div class="answer"> <p>β
Zona pellucida </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> Q 78: Outer layer of ovum formed of follicle cells is called β¦β¦β¦β¦ </div>
<div class="answer"> <p>β
Corona radiata </div>
<button class="answer-button">View Answer</button>
</div>
<p style="font-size: 22px; font-family: Arial; text-align: center; color: #0c8a7d;"><strong>Topic 4: MENSTRUAL CYCLE </strong></p>
<div class="box">
<div class="question"> Q 79: The cyclic events in female reproductive system starting from one menstruation till the next during the reproductive period is called </div>
<div class="answer"> <p>β
Menstrual cycle </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> Q 80: Duration of menstrual cycle is </div>
<div class="answer"> <p>β
28 or 29 days </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> Q 81: First phase of menstrual cycle occurring from 1-5th day is called </div>
<div class="answer"> <p>β
Menstrual phase </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> Q 82: Menstruation occurs due to the breakdown of </div>
<div class="answer"> <p>β
Endometrial lining </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> Q 83: The first menstruation occurring during puberty is called </div>
<div class="answer"> <p>β
Menarche </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> Q 84: Duration of follicular (proliferative) phase is </div>
<div class="answer"> <p>β
5-13th day </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> Q 85: Follicular phase is completed within β¦β¦.. days. </div>
<div class="answer"> <p>β
8-12 </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> Q 86: In which phase, the action of gonadotropins (FSH and LH) from pituitary occurs? </div>
<div class="answer"> <p>β
Follicular phase </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> Q 87: The hormone that stimulates development of primary follicles to Graafian follicles is called </div>
<div class="answer"> <p>β
Follicle Stimulating Hormone (FSH) </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> Q 88: FSH stimulates secretion of oestrogens by β¦β¦β¦β¦. </div>
<div class="answer"> <p>β
Graafian follicles </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> Q 89: Which hormone stimulate proliferation of ruptured uterine endometrium and mucus lining of oviduct & vagina? </div>
<div class="answer"> <p>β
Oestrogens </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> Q 90: In menstrual cycle, ovulatory phase occurs during ........... </div>
<div class="answer"> <p>β
14th day </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> Q 91: Rapid secretion of LH (LH surge) induces rupture of β¦β¦β¦β¦ and thereby ovulation on 14th day. </div>
<div class="answer"> <p>β
Graafian follicle </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> Q 92: The longest phase of menstrual cycle is </div>
<div class="answer"> <p>β
Secretory (Luteal) phase </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> Q 93: After ovulation, Graafian follicle is transformed to a yellow endocrine mass called </div>
<div class="answer"> <p>β
Corpus luteum </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> Q 94: The hormone secreted by corpus luteum is β¦β¦β¦β¦.. </div>
<div class="answer"> <p>β
Progesterone </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> Q 95: The hormone called β¦β¦β¦β¦β¦ makes the endometrium maximum vascular, thick and soft. </div>
<div class="answer"> <p>β
Progesterone </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> Q 96: Progesterone inhibits the β¦β¦β¦β¦.. secretion to prevent development of a second ovarian follicle. </div>
<div class="answer"> <p>β
FSH </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> Q 97: If fertilization does not occur, β¦β¦β¦β¦β¦ degenerates. </div>
<div class="answer"> <p>β
Corpus luteum </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> Q 98: Menstrual cycle ceases around 50 years of age. It is called </div>
<div class="answer"> <p>β
Menopause </div>
<button class="answer-button">View Answer</button>
</div>
<p style="font-size: 22px; font-family: Arial; text-align: center; color: #0c8a7d;"><strong>Topic 5: FERTILIZATION AND IMPLANTATION </strong></p>
<div class="box">
<div class="question"> Q 99: During copulation, semen is released by the penis into the vagina. It is called </div>
<div class="answer"> <p>β
Insemination </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> Q 100: Fusion of a sperm with ovum is called </div>
<div class="answer"> <p>β
Fertilization </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> Q 101: Fertilization occurs in β¦β¦β¦β¦β¦ of fallopian tube. </div>
<div class="answer"> <p>β
Ampullary region </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> Q 102: When a sperm contacts with β¦β¦β¦β¦β¦ layer of ovum, it induces changes in the membrane that block entry of additional sperms. </div>
<div class="answer"> <p>β
Zona pellucida </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> Q 103: The secretions of β¦β¦.β¦β¦ help sperm to enter the egg cytoplasm via zona pellucida & plasma membrane. </div>
<div class="answer"> <p>β
Acrosome </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> Q 104: Fertilization causes second meiotic division of secondary oocyte to form an ovum (ootid) and a </div>
<div class="answer"> <p>β
Second polar body </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> Q 105: The haploid nuclei of the sperm and ovum fuse together to form a diploid </div>
<div class="answer"> <p>β
Zygote </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> Q 106: The sex chromosome pattern in female is XX and that in male is </div>
<div class="answer"> <p>β
XY </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> Q 107: Zygote undergoes mitotic division called β¦β¦β¦β¦ as it moves through the isthmus towards the uterus and forms 2, 4, 8, 16 blastomeres. </div>
<div class="answer"> <p>β
Cleavage </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> Q 108: The embryo with 8-16 blastomeres is called </div>
<div class="answer"> <p>β
Morula </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> Q 109: Morula continues to divide and transforms into </div>
<div class="answer"> <p>β
Blastocyst </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> Q 110: In a blastocyst, blastomeres are arranged into outer layer of β¦β¦β¦β¦.. and an inner cell mass. </div>
<div class="answer"> <p>β
Trophoblast </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> Q 111: Name the structure that gives nourishment to inner cell mass of blastocyst. </div>
<div class="answer"> <p>β
Trophoblast </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> Q 112: After attachment, uterine cells divide rapidly and cover the blastocyst. Thus, the blastocyst becomes embedded in the endometrium. This is called </div>
<div class="answer"> <p>β
Implantation </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> Q 113: The inner cell mass gets differentiated as the </div>
<div class="answer"> <p>β
Embryo </div>
<button class="answer-button">View Answer</button>
</div>
<p style="font-size: 22px; font-family: Arial; text-align: center; color: #0c8a7d;"><strong>Topic 6: PREGNANCY AND EMBRYONIC DEVELOPMENT </strong></p>
<div class="box">
<div class="question"> Q 114: 114. Name the finger-like projections that appear on the trophoblast after implantation. </div>
<div class="answer"> <p>β
Chorionic villi </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> Q 115: The chorionic villi & uterine tissue are interdigitated to form β¦β¦β¦β¦ </div>
<div class="answer"> <p>β
Placenta </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> Q 116: β¦β¦β¦β¦.. is a structural and functional unit between embryo (foetus) and maternal body. </div>
<div class="answer"> <p>β
Placenta </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> Q 117: Placenta is connected to the embryo by an β¦β¦β¦β¦β¦ for transporting substances to and from the embryo. </div>
<div class="answer"> <p>β
Umbilical cord </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> Q 118: Hormones such as Human chorionic gonadotropin (hCG), human placental lactogen (hPL), relaxin etc. are secreted by </div>
<div class="answer"> <p>β
Placenta </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> Q 119: Human pregnancy (gestation period) lasts for </div>
<div class="answer"> <p>β
9 months </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> Q 120: During embryonic development, heart is formed after </div>
<div class="answer"> <p>β
One month </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> Q 121: During embryonic development, Limbs and digits are developed at the end of </div>
<div class="answer"> <p>β
Second month </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> Q 122: When will the most of the major organs are well developed in human embryonic development? </div>
<div class="answer"> <p>β
End of 12 weeks (first trimester) </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> Q 123: First movement of foetus and appearance of hair on the head occurs during </div>
<div class="answer"> <p>β
5th month </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> Q 124: During embryonic development, body is covered with fine hair; eyelids separate and eye lashes form by the end of </div>
<div class="answer"> <p>β
24 weeks (2nd trimester) </div>
<button class="answer-button">View Answer</button>
</div>
<p style="font-size: 22px; font-family: Arial; text-align: center; color: #0c8a7d;"><strong>Topic 7: PARTURITION AND LACTATION </strong></p>
<div class="box">
<div class="question"> Q 125: Process of delivery of the foetus (childbirth) is called </div>
<div class="answer"> <p>β
Parturition </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> Q 126: The signals originating from the foetus and placenta induce mild uterine contractions. It is called </div>
<div class="answer"> <p>β
Foetal ejection reflex </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> Q 127: Foetal ejection reflex causes the release of β¦β¦β¦. from maternal pituitary. </div>
<div class="answer"> <p>β
Oxytocin </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> Q 128: During parturition, which hormone causes stronger uterine muscle contractions? </div>
<div class="answer"> <p>β
Oxytocin </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> Q 129: The continuous uterine muscle contractions lead to expulsion of the baby out of the uterus through the </div>
<div class="answer"> <p>β
Birth canal </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> Q 130: The mammary glands produce milk towards the end of pregnancy. It is called </div>
<div class="answer"> <p>β
Lactation </div>
<button class="answer-button">View Answer</button>
</div>
<div class="box">
<div class="question"> Q 131: The yellowish milk produced during the initial few days of lactation is called </div>
<div class="answer"> <p>β
Colostrum </div>
<button class="answer-button">View Answer</button>
</div>
<script>
// Get all the answer buttons
const answerButtons = document.querySelectorAll('.answer-button');
// Add a click event listener to each answer button
answerButtons.forEach(button => {
button.addEventListener('click', () => {
// Get the answer section for this button
const answerSection = button.previousElementSibling;
// Toggle the answer section's visibility
answerSection.classList.toggle('visible');
// Change the button text to "Hide Answer" or "View Answer"
if (answerSection.classList.contains('visible')) {
button.textContent = 'Hide Answer';
button.classList.add('hide-answer');
} else {
button.textContent = 'View Answer';
button.classList.remove('hide-answer');
}
});
});
</script>
<html>
<head>
<style>
.special-paragraph {
margin-bottom: -10px; /* Adjust this value to reduce the space */
color: #333333;
font-family: Arial, sans-serif;
font-size: 23px;
font-weight: bold;
line-height: 1.5;
padding: 7px;
text-align: center;
border-radius: 10px;
}
.green-bg {
background-color: #ddffd9; /* Green background */
}
.blue-bg {
background-color: #b0eaff; /* Blue background */
}
</style>
</head>
<body>
<p class="special-paragraph green-bg">
<a href="https://www.bankofbiology.com/2020/08/neet-entrance-basic-level-t-10-online.html" style="color: green;"> π Do an Online Test </a>
</p>
<p class="special-paragraph blue-bg">
<a href="https://www.bankofbiology.com/p/question-bank.html" style="color: blue;"> π Questions from other chapters </a>
</p>
</body>
</html>
<div class="blogger-post-footer"><p> Β© copyright 2024 β All rights reserved </p>
<a href=βhttps://www.bankofbiology.comβ>bankofbiology.com</a></div>Abu Raniyahttp://www.blogger.com/profile/14189496606355139812noreply@blogger.com0tag:blogger.com,1999:blog-6823671394482492613.post-69273030914566056282023-12-10T12:41:00.003+05:302023-12-10T12:41:20.191+05:30Elephants - 10 truly amazing facts<div style="text-align: center;"><div class="separator" style="clear: both; text-align: center;"><a href="https://blogger.googleusercontent.com/img/a/AVvXsEiXOwtnkBUzhClPHHFyxSC0JBfUDG6yw9MjHhMBkvYsUu174CFeBBK42N_wkrxfbgxNp2vjB6uqfeDPN5-ATxyRtpo57RLXGUKepUjhOSeZtowMblTOX--M0fuDxUrIr7HCUgpl0eY-aVJ2SzX0q1-Kxw1yHaLTHv3hcSMDaz1X6q0CBaZdnAnpzvWE4AQ" style="margin-left: 1em; margin-right: 1em;"><img alt="" data-original-height="448" data-original-width="622" height="230" src="https://blogger.googleusercontent.com/img/a/AVvXsEiXOwtnkBUzhClPHHFyxSC0JBfUDG6yw9MjHhMBkvYsUu174CFeBBK42N_wkrxfbgxNp2vjB6uqfeDPN5-ATxyRtpo57RLXGUKepUjhOSeZtowMblTOX--M0fuDxUrIr7HCUgpl0eY-aVJ2SzX0q1-Kxw1yHaLTHv3hcSMDaz1X6q0CBaZdnAnpzvWE4AQ" width="320" /></a></div><br /></div>Elephants are incredibly fascinating and majestic creatures. Here are ten truly amazing facts about them:<br /><br /><h2 style="text-align: left;"><span style="color: #3d85c6;">1. Gentle Giants: </span></h2><div>Elephants are the largest land animals on Earth, with African elephants being larger than their Asian counterparts. Despite their size, they are known for their gentle and empathetic behavior towards each other and other species.<br /><br /><h2 style="text-align: left;"><span style="color: #3d85c6;">2. Complex Social Structures: </span></h2></div><div>Elephants live in tight-knit family groups led by a matriarch, usually the oldest and most experienced female. These groups exhibit strong social bonds, caring for each other's young and communicating through a range of vocalizations, body language, and touch.<br /><br /><h2 style="text-align: left;"><span style="color: #3d85c6;">3. Exceptional Memory: </span></h2></div><div>Elephants have remarkable memories and can remember significant locations, paths, and water sources over long periods, aiding them in their nomadic lifestyles.<br /><br /><h2 style="text-align: left;"><span style="color: #3d85c6;">4. Intelligence and Problem-Solving Skills: </span></h2></div><div>They exhibit high levels of intelligence, displaying problem-solving abilities and showing empathy toward other elephants and even animals from different species.<br /><br /><h2 style="text-align: left;"><span style="color: #3d85c6;">5. Remarkable Communication: </span></h2></div><div>Elephants communicate through a variety of sounds, such as trumpeting, rumbling, and growling. They can produce infrasound, low-frequency sounds that travel over long distances and are thought to convey messages across vast areas.<br /><br /><h2 style="text-align: left;"><span style="color: #3d85c6;">6. Highly Sensitive Skin: </span></h2></div><div>Despite their tough appearance, elephants have sensitive skin that is prone to sunburn and insect bites. They use mud and dust baths to protect their skin and regulate their body temperature.<br /><br /><h2 style="text-align: left;"><span style="color: #3d85c6;">7. Complex Trunks: </span></h2></div><div>Their trunks are versatile appendages made of thousands of muscles, enabling them to perform intricate tasks, such as picking up small objects, drinking water, and even "talking" by trumpeting.<br /><br /><h2 style="text-align: left;"><span style="color: #3d85c6;">8. Massive Appetites: </span></h2></div><div>Elephants are herbivores and have enormous appetites, consuming up to 300 pounds (136 kilograms) of food a day, consisting mainly of grasses, leaves, bark, and fruits.<br /><br /><h2 style="text-align: left;"><span style="color: #3d85c6;">9. Important Ecosystem Engineers: </span></h2></div><div>Their feeding habits and migration patterns have a significant impact on their environment, shaping landscapes and creating pathways that benefit other species.<br /><br /><h2 style="text-align: left;"><span style="color: #3d85c6;">10. Threatened Species: </span></h2></div><div>Sadly, elephants are facing numerous threats, including habitat loss, poaching for ivory, and human-elephant conflicts. Conservation efforts are crucial to ensuring their survival.<br /><br />These magnificent creatures possess a combination of physical prowess, emotional depth, and social complexity that makes them truly remarkable and deserving of protection.</div><div class="blogger-post-footer"><p> Β© copyright 2024 β All rights reserved </p>
<a href=βhttps://www.bankofbiology.comβ>bankofbiology.com</a></div>Abu Raniyahttp://www.blogger.com/profile/14189496606355139812noreply@blogger.com0tag:blogger.com,1999:blog-6823671394482492613.post-22597500138942574592023-12-10T12:30:00.001+05:302023-12-10T12:33:35.446+05:30Lungs - 20 Truly Amazing Facts<div style="text-align: center;"><div class="separator" style="clear: both; text-align: center;"><div class="separator" style="clear: both; text-align: center;"><a href="https://blogger.googleusercontent.com/img/a/AVvXsEgRZ5L9LYqdpsG6YIwZr5X6EQ9KleLm3eL5GgImlNCXyqRrtn_Q_YENN6d7eeziCgrFAoXgiCyI467fJTbbwyA_Go-c9kiq3JNu4rnvAeSAemfxzgpo67mRjgJNKXnA7D24F12h_gdStgTRgOwPeVaNpue0WTq8BnJpdJnmTl_rtmD4CxFZYGWy_jC77Fw" style="margin-left: 1em; margin-right: 1em;"><img alt="" data-original-height="415" data-original-width="547" height="194" src="https://blogger.googleusercontent.com/img/a/AVvXsEgRZ5L9LYqdpsG6YIwZr5X6EQ9KleLm3eL5GgImlNCXyqRrtn_Q_YENN6d7eeziCgrFAoXgiCyI467fJTbbwyA_Go-c9kiq3JNu4rnvAeSAemfxzgpo67mRjgJNKXnA7D24F12h_gdStgTRgOwPeVaNpue0WTq8BnJpdJnmTl_rtmD4CxFZYGWy_jC77Fw=w255-h194" width="255" /></a></div></div><br /></div>The lungs are incredible organs with some fascinating characteristics. Here are twenty amazing facts about them:<br /><br /><h2 style="text-align: left;"><span style="color: #3d85c6;">1. Oxygen Exchange: </span></h2><div>Lungs are responsible for the exchange of oxygen and carbon dioxide. Around 300 million tiny air sacs called alveoli facilitate this gas exchange.<br /><br /><h2 style="text-align: left;"><span style="color: #3d85c6;">2. Surface Area: </span></h2></div><div>The surface area of the lungs' air sacs, if spread out, could cover an area roughly equivalent to the size of a tennis court, maximizing the contact between air and blood for efficient gas exchange.<br /><br /><h2 style="text-align: left;"><span style="color: #3d85c6;">3. Breathing Rate: </span></h2></div><div>On average, a person takes around 12 to 20 breaths per minute at rest, but this rate can increase significantly during physical activity or when oxygen demand rises.<br /><br /><h2 style="text-align: left;"><span style="color: #3d85c6;">4. Diaphragm: </span></h2></div><div>The diaphragm, the primary muscle involved in breathing, contracts and relaxes to create changes in lung volume, allowing air to be drawn in (inhalation) and expelled (exhalation).<br /><br /><h2 style="text-align: left;"><span style="color: #3d85c6;">5. Filtering Air: </span></h2></div><div>Lungs not only take in oxygen but also act as filters, removing small blood clots and other small particles that may enter the bloodstream.<br /><br /><h2 style="text-align: left;"><span style="color: #3d85c6;">6. Reserve Capacity: </span></h2></div><div>Lungs have a reserve capacity, allowing individuals to take deeper breaths in times of increased demand, like during exercise or moments requiring more oxygen.<br /><br /><h2 style="text-align: left;"><span style="color: #3d85c6;">7. Stretchiness: </span></h2></div><div>The lungs are incredibly elastic, able to stretch and recoil as air is inhaled and exhaled. This elasticity is due to a protein called elastin in the lung tissue.<br /><br /><h2 style="text-align: left;"><span style="color: #3d85c6;">8. Surfactant Production: </span></h2></div><div>Lungs produce a substance called surfactant that reduces surface tension in the alveoli, preventing them from collapsing when you exhale.<br /><br /><h2 style="text-align: left;"><span style="color: #3d85c6;">9. Blood Oxygenation: </span></h2></div><div>When blood flows through the lungs, it becomes oxygenated. This oxygenated blood then travels to the heart and is pumped throughout the body.<br /><br /><h2 style="text-align: left;"><span style="color: #3d85c6;">10. Mucus Production: </span></h2></div><div>The lungs produce mucus, which traps dust, bacteria, and other particles, allowing tiny hair-like structures called cilia to move it upward where it can be coughed out or swallowed.<br /><br /><h2 style="text-align: left;"><span style="color: #3d85c6;">11. Respiratory Diseases: </span></h2></div><div>Conditions like asthma, chronic obstructive pulmonary disease (COPD), pneumonia, and lung cancer can affect lung function and overall health.<br /><br /><h2 style="text-align: left;"><span style="color: #3d85c6;">12. Rib Cage Protection: </span></h2></div><div>The rib cage protects the lungs from physical injury while allowing for expansion during inhalation.<br /><br /><h2 style="text-align: left;"><span style="color: #3d85c6;">13. Temperature Regulation: </span></h2></div><div>The lungs play a role in regulating body temperature by releasing heat and moisture when breathing out.<br /><br /><h2 style="text-align: left;"><span style="color: #3d85c6;">14. Lung Cancer Risk: </span></h2></div><div>Smoking is the leading cause of lung cancer. About 90% of lung cancer cases are linked to smoking.<br /><br /><h2 style="text-align: left;"><span style="color: #3d85c6;">15. Air Pressure Control: </span></h2></div><div>The lungs help maintain pressure within the chest cavity, allowing the heart to pump blood efficiently.<br /><br /><h2 style="text-align: left;"><span style="color: #3d85c6;">16. Hiccup Control: </span></h2></div><div>Hiccupping involves sudden contractions of the diaphragm and intercostal muscles, potentially helping the body rid itself of trapped air or irritants.<br /><br /><h2 style="text-align: left;"><span style="color: #3d85c6;">17. Breathing Patterns: </span></h2></div><div>Certain breathing techniques, like deep breathing or meditation, can help reduce stress and anxiety by calming the nervous system.<br /><br /><h2 style="text-align: left;"><span style="color: #3d85c6;">18. Lung Transplants: </span></h2></div><div>Lung transplantation is a complex procedure that can be life-saving for individuals with severe lung diseases or failure.<br /><br /><h2 style="text-align: left;"><span style="color: #3d85c6;">19. Secondhand Smoke Effects: </span></h2></div><div>Exposure to secondhand smoke can increase the risk of respiratory infections, asthma, and other lung conditions in non-smokers.<br /><br /><h2 style="text-align: left;"><span style="color: #3d85c6;">20. Unique Blood Flow: </span></h2></div><div>The pulmonary artery carries deoxygenated blood from the heart to the lungs for oxygenation, unlike most arteries that carry oxygenated blood away from the heart.<br /><br />These facts highlight the incredible functions and adaptations of the lungs, showcasing their vital role in our respiratory system and overall health.</div><div class="blogger-post-footer"><p> Β© copyright 2024 β All rights reserved </p>
<a href=βhttps://www.bankofbiology.comβ>bankofbiology.com</a></div>Abu Raniyahttp://www.blogger.com/profile/14189496606355139812noreply@blogger.com0